Gene transcriptions/Boxes/CGCGs/Laboratory

Arabidopsis thaliana, the thale cress or mouse-ear cress is a small flowering plant native to Eurasia and Africa. Credit: Roepers.{{free media}}

A. thaliana is a popular model organism in plant biology and genetics. For a complex multicellular eukaryote, A. thaliana has a relatively small genome of approximately 135 megabase pairs (Mbp).

A laboratory is a specialized activity, a construct, you create where you as a student, teacher, or researcher can have hands-on, or as close to hands-on as possible, experience actively analyzing an entity, source, or object of interest. Usually, there's more to do than just analyzing. The construct is often a room, building or institution equipped for scientific research, experimentation as well as analysis.

This laboratory is a continuation of the previous laboratory.

In the room next door is an astronaut on the Mars expedition, three months along on the six-month journey. A physician and lab assistants have been performing tests on her. Because she has been in zero gravity for more than three months her body chemistry and anatomy now differ from what it was in the controlled gravity environment of Earth. She has lost about 10 % each of her bone, muscle, and brain mass. Comparisons with gene expression sequences now and when on Earth have found that the gene expression for alpha-1-B glycoprotein is not normal. If a way to correct this expression cannot be found she must be returned to Earth maybe to recover, maybe not!

But, it is unlikely she will survive three more months at zero g either to be returned to Earth or put on Mars. Worse, the microgravity may not be the only culprit. There is also the radiation of the interplanetary medium.

You have been tasked to examine her DNA to confirm, especially with the extended data between ZNF497 and A1BG, the presence or absence of CGCG boxes regarding the possible expression of alpha-1-B glycoprotein.

The CGCG boxes are gene transcription factors (TF).

CGCG boxes

"AtSR1 [Arabidopsis thaliana signal-responsive genes] targets the nucleus and specifically recognizes a novel 6-bp CGCG box (A/C/G)CGCG(G/T/C). The multiple CGCG cis-elements are found in promoters of genes such as those involved in ethylene signaling, abscisic acid signaling, and light signal perception. The DNA-binding domain in AtSR1 is located on the N-terminal 146 bp where all AtSR1-related proteins share high similarity but have no similarity to other known DNA-binding proteins. The calmodulin-binding nuclear proteins isolated from wounded leaves exhibit specific CGCG box DNA binding activities. These results suggest that the AtSR gene family encodes a family of calmodulin-binding/DNA-binding proteins involved in multiple signal transduction pathways in plants."

"Ca²⁺-mediated signaling is involved in the transduction of physical signals such as temperature, wind, touch, light, and gravity; oxidative signals such as those arising from pathogen attacks; and hormone signals such as ethylene, abscisic acid (ABA),¹ gibberellins, and auxin (2-7). All these signals have been shown to trigger changes in amplitude or oscillation in cytosolic free Ca²⁺ level. Recently, the signal-induced nuclear free calcium changes were also observed (8). Free Ca²⁺ changes are sensed by a number of Ca²⁺-binding proteins that usually contain a common structural motif, the “EF-hand,” a helix-loop-helix structure (9). One of the best characterized Ca²⁺-binding proteins is calmodulin (CaM), a highly conserved and multifunctional regulatory protein in eukaryotes. Its regulatory activities are triggered by its ability to modulate the activity of a certain set of CaM-binding proteins after binding to Ca²⁺, and thereby generating physiological responses to various stimuli (10-15)."

"The CaM-regulated basic helix-loop-helix family of transcription factors was reported in mammals, where CaM inhibits the protein-DNA interaction by competing with the DNA-binding domain in certain proteins (16)."

"cis-acting elements ACGCGG/CCGCGT were present in the promoter regions of about 130 genes (more than two copies) in Arabidopsis genome."

"The promoter regions are assumed to be within ∼1 kb upstream of the starting transcription site (for the known genes) or the first ATG (for the predicted genes). These genes are related to ethylene signaling (EIN3) and ABA signaling (a putative ABA responsive protein), light perception (phytochrome A, phyA), stress responsive such as the DNA repairing protein, heat shock protein, touch protein (TCH 4), and CaM-regulated ion channel. CaM genes (CaM2 andCaM3) and AtSR6 also contains CGCGcis-elements in their promoter regions."

Consensus sequences

Main resources: Gene transcriptions/Consensus sequences and Consensus sequences

"The minimum DNA-binding elements are 6-bp CGCG box, (A/C/G)CGCG(C/G/T)."

Nucleotides

DNA mapping has been performed. Her DNA for A1BG promoters can be found at Gene_transcriptions/A1BG#Nucleotides.

Programming

Sample programs for preparing test programs are available at Gene transcriptions/A1BG/Programming.

Hypotheses

Main resource: Hypotheses

1. CGCG boxes are not involved in the transcription of A1BG.

Core promoters

Main resources: Gene transcriptions/Core promoters and Core promoters

The diagram shows an overview of the four core promoter elements B recognition element (BRE), TATA box, initiator element (Inr), and downstream promoter element (DPE), with their respective consensus sequences and their distance from the transcription start site. Credit: Jennifer E.F. Butler & James T. Kadonaga.

The core promoter is approximately -34 nts upstream from the TSS.

From the first nucleotide just after ZSCAN22 to the first nucleotide just before A1BG are 4460 nucleotides. The core promoter on this side of A1BG extends from approximately 4425 to the possible transcription start site at nucleotide number 4460.

To extend the analysis from inside and just on the other side of ZNF497 some 3340 nts have been added to the data. This would place the core promoter some 3340 nts further away from the other side of ZNF497. The TSS would be at about 4300 nts with the core promoter starting at 4266.

Def. "the factors, including RNA polymerase II itself, that are minimally essential for transcription in vitro from an isolated core promoter" is called the basal machinery, or basal transcription machinery.

Proximal promoters

Main resources: Gene transcriptions/Proximal promoters and Proximal promoters

Def. a "promoter region [juxtaposed to the core promoter that] binds transcription factors that modify the affinity of the core promoter for RNA polymerase.^[12][13]" is called a proximal promoter.

The proximal sequence upstream of the gene that tends to contain primary regulatory elements is a proximal promoter.

It is approximately 250 base pairs or nucleotides, nts, upstream of the transcription start site.

The proximal promoter begins about nucleotide number 4210 in the negative direction.

The proximal promoter begins about nucleotide number 4195 in the positive direction.

Distal promoters

Main resources: Gene transcriptions/Distal promoters and Distal promoters

The "upstream regions of the human [cytochrome P450 family 11 subfamily A] CYP11A and bovine CYP11B genes [have] a distal promoter in each gene. The distal promoters are located at −1.8 to −1.5 kb in the upstream region of the CYP11A gene and −1.5 to −1.1 kb in the upstream region of the CYP11B gene."

"Using cloned chicken β^A-globin genes, either individually or within the natural chromosomal locus, enhancer-dependent transcription is achieved in vitro at a distance of 2 kb with developmentally staged erythroid extracts. This occurs by promoter derepression and is critically dependent upon DNA topology. In the presence of the enhancer, genes must exist in a supercoiled conformation to be actively transcribed, whereas relaxed or linear templates are inactive. Distal protein–protein interactions in vitro may be favored on supercoiled DNA because of topological constraints."

Distal promoter regions may be a relatively small number of nucleotides, fairly close to the TSS such as (-253 to -54) or several regions of different lengths, many nucleotides away, such as (-2732 to -2600) and (-2830 to -2800).

The "[d]istal promoter is not a spacer element."

Using an estimate of 2 knts, a distal promoter to A1BG would be expected after nucleotide number 2460.

Any transcription factor before A1BG from the direction of ZN497 may be out to 2300 nts.

Samplings

Main resources: Models/Samplings and Samplings

Regarding hypothesis 1

For the Basic programs (starting with SuccessablesCGCG.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

1. negative strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesCGCG--.bas, looking for 3'-(A/C/G)CGCG(C/G/T)-5', 2, 3'-GCGCGT-5', 161, 3'-CCGCGC-5', 1761,
2. negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesCGCG-+.bas, looking for 3'-(A/C/G)CGCG(C/G/T)-5', 8, 3'-GCGCGT-5', 543, 3'-CCGCGC-5', 681, 3'-GCGCGC-5', 683, 3'-ACGCGG-5', 871, 3'-ACGCGG-5', 971, 3'-CCGCGG-5', 1337, 3'-CCGCGG-5', 1437, 3'-CCGCGC-5', 1650,
3. positive strand in the negative direction is SuccessablesCGCG+-.bas, looking for 3'-(A/C/G)CGCG(C/G/T)-5', 1, 3'-GCGCGG-5', 1762,
4. positive strand in the positive direction is SuccessablesCGCG++.bas, looking for 3'-(A/C/G)CGCG(C/G/T)-5', 22, 3'-CCGCGC-5', 161, 3'-ACGCGG-5', 452, 3'-CCGCGC-5', 542, 3'-GCGCGC-5', 682, 3'-GCGCGT-5', 684, 3'-CCGCGT-5', 876, 3'-CCGCGT-5', 976, 3'-CCGCGT-5', 1046, 3'-ACGCGG-5', 1078, 3'-ACGCGG-5', 1162, 3'-CCGCGC-5', 1214, 3'-ACGCGG-5', 1246, 3'-CCGCGT-5', 1298, 3'-ACGCGT-5', 1314, 3'-ACGCGG-5', 1354, 3'-ACGCGG-5', 1398, 3'-ACGCGT-5', 1414, 3'-ACGCGG-5', 1454, 3'-ACGCGG-5', 1498, 3'-ACGCGT-5', 1523, 3'-CCGCGT-5', 1550, 3'-CCGCGG-5', 1769,
5. complement, negative strand, negative direction is SuccessablesCGCGc--.bas, looking for 3'-(C/G/T)GCGC(A/C/G)-5', 1, 3'-CGCGCC-5', 1762,
6. complement, negative strand, positive direction is SuccessablesCGCGc-+.bas, looking for 3'-(C/G/T)GCGC(A/C/G)-5', 22, 3'-GGCGCG-5', 161, 3'-TGCGCC-5', 452, 3'-GGCGCG-5', 542, 3'-CGCGCG-5', 682, 3'-CGCGCA-5', 684, 3'-GGCGCA-5', 876, 3'-GGCGCA-5', 976, 3'-GGCGCA-5', 1046, 3'-TGCGCC-5', 1078, 3'-TGCGCC-5', 1162, 3'-GGCGCG-5', 1214, 3'-TGCGCC-5', 1246, 3'-GGCGCA-5', 1298, 3'-TGCGCA-5', 1314, 3'-TGCGCC-5', 1354, 3'-TGCGCC-5', 1398, 3'-TGCGCA-5', 1414, 3'-TGCGCC-5', 1454, 3'-TGCGCC-5', 1498, 3'-TGCGCA-5', 1523, 3'-GGCGCA-5', 1550, 3'-GGCGCC-5', 1769,
7. complement, positive strand, negative direction is SuccessablesCGCGc+-.bas, looking for 3'-(C/G/T)GCGC(A/C/G)-5', 2, 3'-CGCGCA-5', 161, 3'-GGCGCG-5', 1761,
8. complement, positive strand, positive direction is SuccessablesCGCGc++.bas, looking for 3'-(C/G/T)GCGC(A/C/G)-5', 8, 3'-CGCGCA-5', 543, 3'-GGCGCG-5', 681, 3'-CGCGCG-5', 683, 3'-TGCGCC-5', 871, 3'-TGCGCC-5', 971, 3'-GGCGCC-5', 1337, 3'-GGCGCC-5', 1437, 3'-GGCGCG-5', 1650,
9. inverse complement, negative strand, negative direction is SuccessablesCGCGci--.bas, looking for 3'-(A/C/G)CGCG(C/G/T)-5', 2, 3'-GCGCGT-5', 161, 3'-CCGCGC-5', 1761,
10. inverse complement, negative strand, positive direction is SuccessablesCGCGci-+.bas, looking for 3'-(A/C/G)CGCG(C/G/T)-5', 8, 3'-GCGCGT-5', 543, 3'-CCGCGC-5', 681, 3'-GCGCGC-5', 683, 3'-ACGCGG-5', 871, 3'-ACGCGG-5', 971, 3'-CCGCGG-5', 1337, 3'-CCGCGG-5', 1437, 3'-CCGCGC-5', 1650,
11. inverse complement, positive strand, negative direction is SuccessablesCGCGci+-.bas, looking for 3'-(A/C/G)CGCG(C/G/T)-5', 1, 3'-GCGCGG-5', 1762,
12. inverse complement, positive strand, positive direction is SuccessablesCGCGci++.bas, looking for 3'-(A/C/G)CGCG(C/G/T)-5', 22, 3'-CCGCGC-5', 161, 3'-ACGCGG-5', 452, 3'-CCGCGC-5', 542, 3'-GCGCGC-5', 682, 3'-GCGCGT-5', 684, 3'-CCGCGT-5', 876, 3'-CCGCGT-5', 976, 3'-CCGCGT-5', 1046, 3'-ACGCGG-5', 1078, 3'-ACGCGG-5', 1162, 3'-CCGCGC-5', 1214, 3'-ACGCGG-5', 1246, 3'-CCGCGT-5', 1298, 3'-ACGCGT-5', 1314, 3'-ACGCGG-5', 1354, 3'-ACGCGG-5', 1398, 3'-ACGCGT-5', 1414, 3'-ACGCGG-5', 1454, 3'-ACGCGG-5', 1498, 3'-ACGCGT-5', 1523, 3'-CCGCGT-5', 1550, 3'-CCGCGG-5', 1769,
13. inverse, negative strand, negative direction, is SuccessablesCGCGi--.bas, looking for 3'-(C/G/T)GCGC(A/C/G)-5', 1, 3'-CGCGCC-5', 1762,
14. inverse, negative strand, positive direction, is SuccessablesCGCGi-+.bas, looking for 3'-(C/G/T)GCGC(A/C/G)-5', 22, 3'-GGCGCG-5', 161, 3'-TGCGCC-5', 452, 3'-GGCGCG-5', 542, 3'-CGCGCG-5', 682, 3'-CGCGCA-5', 684, 3'-GGCGCA-5', 876, 3'-GGCGCA-5', 976, 3'-GGCGCA-5', 1046, 3'-TGCGCC-5', 1078, 3'-TGCGCC-5', 1162, 3'-GGCGCG-5', 1214, 3'-TGCGCC-5', 1246, 3'-GGCGCA-5', 1298, 3'-TGCGCA-5', 1314, 3'-TGCGCC-5', 1354, 3'-TGCGCC-5', 1398, 3'-TGCGCA-5', 1414, 3'-TGCGCC-5', 1454, 3'-TGCGCC-5', 1498, 3'-TGCGCA-5', 1523, 3'-GGCGCA-5', 1550, 3'-GGCGCC-5', 1769,
15. inverse, positive strand, negative direction, is SuccessablesCGCGi+-.bas, looking for 3'-(C/G/T)GCGC(A/C/G)-5', 2, 3'-CGCGCA-5', 161, 3'-GGCGCG-5', 1761,
16. inverse, positive strand, positive direction, is SuccessablesCGCGi++.bas, looking for 3'-(C/G/T)GCGC(A/C/G)-5', 8, 3'-CGCGCA-5', 543, 3'-GGCGCG-5', 681, 3'-CGCGCG-5', 683, 3'-TGCGCC-5', 871, 3'-TGCGCC-5', 971, 3'-GGCGCC-5', 1337, 3'-GGCGCC-5', 1437, 3'-GGCGCG-5', 1650.

Verifications

Main resources: Assessments/Verifications and Verifications

To verify that your sampling has explored something, you may need a control group. Perhaps where, when, or without your entity, source, or object may serve.

Another verifier is reproducibility. Can you replicate something about your entity in your laboratory more than 3 times. Five times is usually a beginning number to provide statistics (data) about it.

For an apparent one time or perception event, document or record as much information coincident as possible. Was there a butterfly nearby?

Has anyone else perceived the entity and recorded something about it?

Gene ID: 1, includes the nucleotides between neighboring genes and A1BG. These nucleotides can be loaded into files from either gene toward A1BG, and from template and coding strands. These nucleotide sequences can be found in Gene transcriptions/A1BG. Copying the above discovered CGCG boxes and putting the sequences in "⌘F" locates these sequences in the same nucleotide positions as found by the computer programs.

Core promoters CGCG boxes

Main resources: Gene transcriptions/Core promoters and Core promoters

From the first nucleotide just after ZSCAN22 to the first nucleotide just before A1BG are 4460 nucleotides. The core promoter on this side of A1BG extends from approximately 4425 to the possible transcription start site at nucleotide number 4460.

On the negative strand in the negative direction (from ZSCAN22 to A1BG), looking for 3'-(A/C/G)CGCG(C/G/T)-5', there no CGCG boxes in the core promoter.

From the first nucleotide just after ZNF497 to the first nucleotide just before A1BG are 858 nucleotides. The core promoter on this side of A1BG extends from approximately 824 to the possible transcription start site at nucleotide number 858. Nucleotides (nts) have been added from ZNF497 to A1BG. The TSS for A1BG is now at 4300 nts from just on the other side of ZNF497. The core promoter should now be from 4266 to 4300.

On the negative strand in the positive direction (from ZNF497 to A1BG), looking for 3'-(A/C/G)CGCG(C/G/T)-5', there no CGCG boxes in the core promoter.

Proximal promoter CGCG boxes

Main resources: Gene transcriptions/Proximal promoters and Proximal promoters

The proximal promoter begins about nucleotide number 4210 in the negative direction.

There are no CGCG boxes in the negative direction.

The proximal promoter begins about nucleotide number 4195 in the positive direction.

There are no CGCG boxes in the positive direction.

Distal promoter CGCG boxes

Main resources: Gene transcriptions/Distal promoters and Distal promoters

Using an estimate of 2 knts, a distal promoter to A1BG would be expected after nucleotide number 2460.

There are no CGCG boxes after nucleotide number 2460.

There are no CGCG boxes after nucleotide number 2300.

All of the CGCG boxes found are more closely associated with ZSCAN22 or ZNF497 than A1BG.

Transcribed CGCG boxes

"Biochemical studies with the Arabidopsis AtSR1 and rice OsCBT proteins have identified the primary target of DNA cis-element for [calmodulin-binding transcription activator] SR/CAMTA proteins as CGCG and CGTG motifs in promoter regions of the target genes [12],[14]."

"The function of SR/CAMTA proteins in plant biotic and abiotic stress response is achieved mainly through regulating expression of genes whose promoter regions contain the CGCG boxes [20],[21],[25],[27]."

The "Arabidopsis sr1 mutant plants contained high level of [salicylic acid] SA and had upregulated expression of defense and signaling genes [19],[20] and that [serine/threonine protein kinase 1] AtSR1 can bind to the CGCG box in the promoters of [enhanced disease susceptibility 1] EDS1, [nodal-related 1] NDR1 and [ethylene insensitive 3 family protein] EIN3[20],[21], indicating the involvements of AtSR1 in the SA- and [ethylene] ET-mediated signaling pathways."

The "Arabidopsis AtSR1 could bind to the CGCG box, a characteristic cis-elements for the SR proteins [12], in the promoter region of EDS1 and suppressed the expression of EDS1[20], which is critical to biosynthesis of SA. Bioinformatics analysis also identified a CGCG box within 1.3 Kb from the starting codon in the promoter of tomato SlEDS1 gene [30]."

The "Arabidopsis AtSR1 was shown to bind to the CGCG box in the promoters of the EDS1, NDR1 and EIN3 genes and repress their expression [20],[21]."

Laboratory reports

Below is an outline for sections of a report, paper, manuscript, log book entry, or lab book entry. You may create your own, of course.

CGCG box transcription laboratory

by --Marshallsumter (discuss • contribs) 03:37, 27 July 2018 (UTC)

Abstract

Using small computer programs to test the archetype genome stored at NCBI Gene, no CGCG boxes occur in the core, proximal or distal portions of the gene promoter that produces A1BG to confirm that CGCG boxes are involved in its transcription.

Introduction

According to one source, A1BG is transcribed from the direction of ZNF497: 3' - 58864890: CGAGCCACCCCACCGCCCTCCCTTGG₊₁GGCCTCATTGCTGCAGACGCTCACCCCAGACACTCACTGCACCGGAGTGAGCGCGACCATCATG : 58866601-5', per Michael David Winther, Leah Christine Knickle, Martin Haardt, Stephen John Allen, Andre Ponton, Roberto Justo De Antueno, Kenneth Jenkins, Solomon O. Nwaka, and Y. Paul Goldberg, Fat Regulated Genes, Uses Thereof and Compounds for Mudulating Same, US Patent Office, July 29, 2004, at http://www.google.com/patents?hl=en&lr=&vid=USPATAPP10416914&id=7iaVAAAAEBAJ&oi=fnd&printsec=abstract#v=onepage&q&f=false where the second 'G' at left of four Gs in a row is the TSS. Transcription was triggered in cell cultures and the transcription start site was found using reverse transcriptase. But, the mechanism for transcription is unknown.

Controlling the transcription of A1BG may have significant immune function against snake envenomation. A1BG forms a complex that is similar to those formed between toxins from snake venom and A1BG-like plasma proteins. These inhibit the toxic effect of snake venom metalloproteinases or myotoxins and protect the animal from envenomation.

Transcription factors

Many transcription factors (TFs) may occur upstream and occasionally downstream of the transcription start site (TSS), in this gene's promoter. The following have been examined so far: (1) AGC boxes (GCC boxes), (2) ATA boxes, (3) C and D boxes, (4) CArG boxes, (5) enhancer boxes, (6) Factor II B recognition elements, (7) HNF6s, (8) HY boxes, (9) metal responsive elements (MREs), (10) STAT5s, and (11) TATA boxes.

AGC boxes (GCC boxes)

An AGC box was found in the distal promoter of either gene ZSCAN22 or A1BG on both the template and coding strands. But, as the only known transcription of A1BG occurs between Gene ID: 162968 ZNF497 and Gene ID: 1 A1BG, it is unlikely that this AGC box is naturally used to transcribe A1BG.

A full web search produced several references including a GeneCard for "zinc finger protein 497" and "GCC box", including "May be involved in transcriptional regulation." Zinc fingers are mentioned in association with GCC boxes in plants. It seems unlikely that an AGC box is involved in any way with the transcription of A1BG.

An extension of the nucleotide data for the positive direction from ZNF475 toward A1BG from 958 nts to 4445 nts has not discovered any AGC boxes even in the distal promoter just beyond ZNF497.

ATA boxes

Regarding hypothesis 1: there are no ATA boxes in the core promoter of A1BG from either direction or strand. This hypothesis has been shown to be true. A corollary hypothesis might be 1.1: there are no ATA boxes in the proximal promoter of A1BG from either direction or strand. This corollary hypothesis may be true. "The analysis of the promoter region indicated that a putative ATA box is located 54 nucleotides upstream from the transcription start site". There is one inverse and inverse complement ATA box in the proximal promoter in the positive direction between 4050 and 4300: 3'-AAATAA-5' at 4142, and 3'-TTTATT-5' at 4142. As the TSS is at 4300 nts, this ATA box is some 158 nts away, where with the smaller data set 3'-TTTATT-5' was at 703. As the TSS is at 858 nts, this ATA box is some 155 nts away, which is approximately the same number of nts from the TSS but not close enough to be in the core promoter and not 54 nts upstream from the TSS or to match other such genes with an ATA box.

But the ATA box at 2347 is likely involved in transcription of A1BG in analogy to the rat. Although this has not been confirmed as involved, the existence of this ATA box likely proves hypothesis 1 false.

Regarding hypothesis 2: ATA boxes have a role as downstream signal transducers in A1BG. There is the following inverse ATA box on the negative strand, negative direction: 3'-AAATAA-5' at 4537. On this strand, in this direction the TSS is at 4460 nts from ZSCAN22. This ATA box is 77 nts downstream. So far no published research has been found to verify this type of downstream promoter or enhancer ATA box. There may be another isoform TSS nearby. As such, hypothesis 2 may be true.

Regarding hypothesis 3: ATA boxes may assist transcription of A1BG by other transcription factors. This hypothesis has been shown by literature search to be true. But, none of the ATA boxes for A1BG are close enough to any STAT5 promoter to match known transcription initiation.

C and D boxes

Regarding hypothesis 1: The C and D boxes are not involved in the transcription of A1BG.

There are no C boxes or D boxes in the core promoter from approximately 4425 to the possible transcription start site at nucleotide number 4460.

There are no C boxes or D boxes in the core promoter from approximately 4266 to the possible transcription start site at nucleotide number 4300.

There are no C boxes or D boxes in the proximal promoter beginning about nucleotide number 4210 in the negative direction.

There is one C box 3'-ACATCA-5' at 4116 but no D boxes in the proximal promoter beginning about nucleotide number 4050 in the positive direction.

There are four C boxes in the distal promoter: 3'-AGTAGT-5' at 2888, 3'-AGTAGT-5' at 2944, 3'-AGTAGT-5' at 3418, and 3'-AGTAGT-5' at 3521 on the negative strand in the negative direction and its complement on the positive strand.

There is one D box in the distal promoter: 3'-AGTCTG-5' at 2947 on the negative strand in the negative direction and its complement on the positive strand.

There is one C box in the distal promoter: 3'-TCATCA-5' at 3251 on the negative strand in the positive direction and its complement on the positive strand.

There is one D box in the distal promoter: 3'-AGTCTG-5' at 3923 on the negative strand in the positive direction and its complement on the positive strand.

Regarding hypothesis 2: If involved they assist transcription by other TFs.

A Google scholar search using key words: "C box", "D box", and A1BG produced zero results.

Regarding hypothesis 3: C and D boxes occur only in the proximal promoter.

GeneID: 60674 GAS5 growth arrest specific 5 (non-protein coding). "This gene produces a spliced long non-coding RNA and is a member of the 5' terminal oligo-pyrimidine class of genes. It is a small nucleolar RNA host gene, containing multiple C/D box snoRNA genes in its introns. Part of the secondary RNA structure of the encoded transcript mimics glucocorticoid response element (GRE) which means it can bind to the DNA binding domain of the glucocorticoid receptor (nuclear receptor subfamily 3, group C, member 1). This action blocks the glucocorticoid receptor from being activated and thereby stops it from regulating the transcription of its target genes. This transcript is also thought to regulate the transcriptional activity of other receptors, such as androgen, progesterone and mineralocorticoid receptors, that can bind to its GRE mimic region. Multiple functions have been associated with this transcript, including cellular growth arrest and apoptosis. It has also been identified as a potential tumor suppressor, with its down-regulation associated with cancer in multiple different tissues."

"The antisense elements located immediately upstream of the D box and/or the D′ box match the sequence of the target RNA, while the areas immediately upstream of the C box and immediately downstream of the D box form a 5′–3′ terminal stem".

"Small nucleolar RNAs (snoRNAs) are noncoding RNAs involved in the processing and modification of ribosomal RNAs. They are grouped in two distinct families, the box C/D family, which catalyzes methylation of 2′-hydroxyls of the pre-rRNA precursor, and the box H/ACA family, which catalyzes the modification of uridines into pseudouridines in various RNAs (reviewed in Refs. [24] and [40])."

"Small nucleolar RNAs (snoRNAs) are 60–300-nucleotide-long RNAs located in the nucleolus or in Cajal bodies. They constitute one of the most abundant classes of ncRNAs [9]. Predominantly intronic, 300 different snoRNA sequences are located in the human genome. They are classified into two categories, those containing boxes C and D; and, those containing boxes H and ACA. snoRNAs are generated after splicing, debranching, and trimming of mRNA introns. Subsequently, mature snoRNAs associate with proteins to form small nucleolar ribonucleoproteins (snoRNPs). These complexes are exported into the nucleolus to participate in rRNA processing [5]."

Tiny "RNAs with a modal length of 18 nt [...] map within -60 to +120 nt of transcription start sites (TSSs) in human, chicken and Drosophila. These transcription initiation RNAs (tiRNAs) are derived from sequences on the same strand as the TSS and are preferentially associated with G+C-rich promoters. The 5' ends of tiRNAs show peak density 10-30 nt downstream of TSSs, indicating that they are processed. tiRNAs are generally, although not exclusively, associated with highly expressed transcripts and sites of RNA polymerase II binding."

"With exception of U3 all box C/D snoRNAs presented in this study are intron-encoded, as it is the general pathway for the biogenesis of this class of snoRNAs (22)."

"Box C/D snoRNAs [...] contain conserved Box C (UGAUGA) and Box D (CUGA) elements located closely to the 5′- and 3′-ends, respectively. Internal copies of these elements are termed Box C′ and Box D′ (20,21)."

Gene ID: 7422 VEGFA vascular endothelial growth factor A. "This gene is a member of the PDGF/VEGF growth factor family. It encodes a heparin-binding protein, which exists as a disulfide-linked homodimer. This growth factor induces proliferation and migration of vascular endothelial cells, and is essential for both physiological and pathological angiogenesis. Disruption of this gene in mice resulted in abnormal embryonic blood vessel formation. This gene is upregulated in many known tumors and its expression is correlated with tumor stage and progression. Elevated levels of this protein are found in patients with POEMS syndrome, also known as Crow-Fukase syndrome. Allelic variants of this gene have been associated with microvascular complications of diabetes 1 (MVCD1) and atherosclerosis. Alternatively spliced transcript variants encoding different isoforms have been described. There is also evidence for alternative translation initiation from upstream non-AUG (CUG) codons resulting in additional isoforms. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is antiangiogenic. Expression of some isoforms derived from the AUG start codon is regulated by a small upstream open reading frame, which is located within an internal ribosome entry site."

CArG boxes

By combining a literature search with computer analysis of each promoter between ZSCAN22 and A1BG and ZNF497 and A1BG, CArG boxes have been found. To show that these CArG boxes may be used during or for transcription of A1BG at least one transcription factor has been affirmed.

A literature search of more recent results discovered: "Of the [Flowering Locus C] FLC binding sites, 69% contained at least one CArG-box motif with the core consensus sequence CCAAAAAT(G/A)G and an AAA extension at the 3′ end [. Three] other MADS-box flowering-time regulators, SOC1, SVP, and AGAMOUS-LIKE 24 (AGL24), bind to two different CArG-box motifs at 502 bp (CTAAATATGG) and 287 bp (CAATAATTGG) upstream of the translation start in the SEP3 gene (24), consistent with different specificities for the different MADS-box proteins."

These together with the core motif CC(A/T)₆GG suggest a more general CArG-box motif of (C(C/A/T)(A/T)₆(A/G)G). Subsequent computer-program testing revealed two more general CArG boxes: 3'-CAAAAAAAAG-5' at 1399 nts from ZSCAN22 and 3'-CATTAAAAGG-5' at 3441 nts from ZSCAN22, but none within 4300 nts toward A1BG from ZNF497.

These results show that the presence of CArG boxes on the ZSCAN22 side of A1BG implies their use when transcribing A1BG, although they may be pointing toward ZSCAN22. These suggest that the hypothesis (A1BG is not transcribed by a CArG box) is false. Regarding the second hypothesis (The lack of a CArG box on either side of A1BG does not prove that it is not actively used to transcribe A1BG), the presence of more general CArG boxes in the distal promoter tentatively confirms this hypothesis.

CArG boxes do occur in the distal promoter of A1BG on the ZSCAN22 side only. And, it is likely that a CArG box is involved in some way with the transcription of A1BG.

Enhancer boxes

The presence of many enhancer boxes on both sides of A1BG demonstrate that the hypothesis: "A1BG is not transcribed by an enhancer box", is false.

The finding by literature search of evidence verifying that at least one transcription factor can enhance or inhibit the transcription of A1BG using one or more enhancer boxes disproves the hypothesis: "Existence of an enhancer box on either side of A1BG does not prove that it is actively used to transcribe A1BG".

Enhancer boxes do occur in the proximal and distal promoters of A1BG. And, it is likely that an enhancer box is involved in some way with the transcription of A1BG.

Factor II B recognition elements

Regarding hypothesis 1: B recognition element (BRE^u) is not involved in the transcription of A1BG.

In the negative direction, there are no BREs (BRE^u) in the core promoter from approximately 4425 to the possible transcription start site at nucleotide number 4460.

In the positive direction, there are no BREs (BRE^u) in the core promoter from approximately 4266 to the possible transcription start site at nucleotide number 4300.

There are no BREs (BRE^u) in the proximal promoter beginning about nucleotide number 4210 in the negative direction.

There are no BREs (BRE^u) in the proximal promoter beginning about nucleotide number 4050 in the positive direction.

There is one BRE^u in the distal promoter: 3'-CCGCACC-5' at 3047 on the negative strand in the negative direction and its complement on the positive strand.

There is one BRE in the distal promoter: 3'-CCGCACC-5' at 2566 on the negative strand in the positive direction and its complement on the positive strand.

Regarding hypothesis 2: If involved it assists transcription by other TFs.

A search of Google Scholar and the full web failed to produce any examples of BRE^u assisted A1BG transcription.

"A computational study based on statistical analysis of curated promoter sets concluded that up to 25% of human core promoters contain a potential BREu. The motif was found to be enriched in CpG promoters (>30% frequency) but depleted in CpG-less promoters (<10% frequency) [14]."

HNF6s

HNF6s may have a downstream proximal promoter element if the computer nts sampling is additionally, approximately at least 250 nts downstream of the transcription start site. "Downstream" can refer to downstream from an enhancer but before the transcription start site, downstream from a TATA box or an initiator element but before the transcription start site (TSS), downstream from another promoter element and containing the TSS, or downstream after the TSS. The computer programs written to test for HNF6 promoters were limited to 100 nts below the apparent TSSs.

There is a HNF6 on the negative strand in the positive direction (from ZNF497 to A1BG) of 3'-TTCCGGGAA-5' at 808 in the proximal promoter, where the TSS is at 858 nts from ZNF497.

There is no such "downstream" promoter between ZSCAN22 and A1BG.

Both a TATA box or an Inr are within the core promoter. There are no HNF6s within any core promoters per the computer program sampling from ZNF497 or ZSCAN22 and A1BG.

There are no HNF6s within any core promoters per the computer program sampling from ZNF497 or ZSCAN22 and A1BG containing either TSS.

No HNF6s were detected at least to 100 nts downstream of each TSS.

There is a HNF6 on the negative strand in the positive direction (from ZNF497 to A1BG) of 3'-TTCCGGGAA-5' at 808 in the proximal promoter, where the TSS is at 858 nts from ZNF497. This direction is the only confirmed transcription of A1BG; therefore, it is likely A1BG is transcribed using this HNF6 transcription factor.

There are two HNF6s on the negative strand in the negative direction, 3'-AAGCAACTT-5' at 3506 and 3'-AAGGGACTT-5' at 3782. Both of these are in the distal promoter between ZSCAN22 and A1BG.

The only known TSS for A1BG lies at 4300 nts from just beyond ZNF497 toward A1BG. There two HNF6s in the proximal promoter between 4050 and 4300, 3'-TTATTGATTA-5' at 4164 and 3'-TATAATTGTT-5' at 4172, i.e. outside from 4242 (-58) to 4250 (-50). This suggests that HNF6 assists in the transcription of A1BG, but not downstream of the TSS.

File:Liver expression of a1bg-luciferase constructs.jpg

Liver expression of a1bg-luciferase constructs is diagrammed. Credit: Cissi Gardmo and Agneta Mode.{{fairuse}}

Both "the 2.3 kb and the 160 bp proximal parts of the a1bg promoter direct sex-specific expression of the reporter gene, and that a negative regulatory element resides in the −1 kb to −160 bp region."

"Computer analysis of the 2.3 kb rat a1bg promoter fragment revealed two putative HNF6 sites and one [hepatic nuclear factor 6] HNF6/HNF3 binding site at −2077/−2069, −69/−61 and −137/−128 respectively [...]."

The "GH-dependent sexually dimorphic expression conveyed by the 2.3 kb a1bg promoter is enhanced by the HNF6/HNF3 site [...]."

"HNF6 bound to the a1bg HNF6 oligonucleotide, but in this case, the mutated oligonucleotide was able to compete for binding when added in large excess [...]. However, [...] the HNF6 binding capacity of the mutated oligonucleotide was clearly reduced. A 20 molar excess of the mutated oligonucleotide had only a marginal effect on the binding of HNF6 [...], whereas a 20 molar excess of unlabelled probe [...] completely abolished binding. Supershift analysis with an HNF6 antibody revealed a complex with a slightly lower mobility than the HNF6 complex [...]. By extending the electrophoresis run and including nuclear extract from hypophysectomized rats, devoid of GH and thereby lacking HNF6 (Lahuna et al. 1997), the two different complexes were clearly visualized. The complex with the lower mobility is most probably due to the binding of HNF3, in analogy with what was shown by Lahuna et al. for the CYP2C12 HNF6 binding site; HNF3 can bind to the site in the absence of HNF6 (Lahuna et al. 1997). [...] HNF6 could bind to their respective site in the a1bg promoter in vitro, and the mutations introduced in respective site abolished binding of the corresponding factor."

The "expression of a −116/−89 deletion construct in which also the HNF6 site was mutated, (−116/−89) delmutHNF6-Luc, [...] the generated luciferase activities were reduced in both sexes [...]. This is in contrast to that mutation/deletion of the sites separately only affected the expression in female livers."

The "−116/−89 region contains a site(s) of importance for the GH-dependent and female-specific expression of the a1bg gene, and that the impact of this region together with the HNF6 site is more complex than mere enhancement of the expression in females."

Following "mutation of the HNF6-binding element, mutHNF6-Luc, the sex-differentiated expression was attenuated due to reduced expression in females. Thus, for a1bg, the sex-related difference in amount of HNF6 is likely to contribute to the sex-differentiated and female characteristic expression."

Nuclear "proteins binding to the a1bg −116/−89 region [are] members of the [nuclear factor 1] NF1 and the [octamer transcription factor] Oct families of transcription factors. NF1 genes are expressed in most adult tissues (Osada et al. 1999). It is not known how NF1 modulates transcriptional activity, and both activation and repression of transcription have been reported (Gronostajski 2000). Cofactors such as CBP/p300 and HDAC have been shown to interact with NF1 proteins suggesting modulation of chromatin structure (Chaudhry et al. 1999). NF1 factors have also been shown to interact directly with the basal transcription machinery as well as with other transcription factors, including Stat5 (Kim & Roeder 1994, Mukhopadhyay et al. 2001) and synergistic effects with HNF4 have been reported (Ulvila et al. 2004). In addition to the HNF6, Stat5 and NF1/Oct sites, the a1bg promoter harbours an imperfect HNF4 site at −51/−39 with two mismatches compared with the HNF4 consensus site. HNF4 is clearly important for the expression of CYP2C12 (Sasaki et al. 1999), however, the −51/−39 region in a1bg was not protected in the footprinting analysis and was therefore not analysed further. Like NF1, Oct proteins have been reported to be involved in activation as well as repression of gene expression (Phillips & Luisi 2000). [...] Moreover, NF1 and Oct-1 have been shown to, reciprocally, facilitate each other’s binding (O’Connor & Bernard 1995, Belikov et al. 2004)."

In the diagram on the right is liver "expression of a1bg-luciferase constructs. (A) Stat5 and HNF6 consensus sequences and corresponding sites in the 2.3 kb a1bg promoter alongside with the used mutations. (B) Female (black bars) and male (open bars) rats [results]."

"Computer analysis of the 2.3 kb rat a1bg promoter fragment revealed [a] HNF6 [site] at [...] −69/−61 [...]."

The murine downstream promoter element is only 11 nts displaced from the human one. This suggests a HNF6 participation in human gene transcription of A1BG.

"Computer analysis of the 2.3 kb rat a1bg promoter fragment revealed two putative HNF6 sites [...] at −2077/−2069 [and] −69/−61 [...]."

There are two HNF6s on the negative strand in the negative direction, 3'-AAGCAACTT-5' at 3506 (-954) and 3'-AAGGGACTT-5' at 3782 (-678) in the distal promoter between ZSCAN22 and A1BG. Although much closer than their likely murine counterparts, they are on the other side of A1BG from the HNF6 site confirming hypothesis 1. If active in humans or murine-like HNF6s occur within or beyond ZNF497 in this distal promoter, then human A1BG is transcribed using HNF6 promoters disproving hypothesis 2.

A Google Scholar search using ZNF497 with HNF6 found no articles discussing HNF6 sites inside or associated with ZNF497. To confirm they exist, a data file going 4300 nts to just beyond ZNF497 has been created and tested for a distal promoter on this side. Distal HNF6s in the positive direction, if they exist, would be inside ZNF497 or beyond, e.g., 3'-ATGTCCATGG-5' at 3581 was found.

Literature search has found that HNF6s assist transcription of A1BG by other transcription factors. The proximal HNF6 promoter is -58 to -50 from A1BG TSS. If another HNF6 promoter is at -2.3 kb, it is about -1.4 kb inside ZNF497 which is 3212 nts long. Per analogy to the rat this would be expected.

Per earlier laboratories transcription factors may occur in the distal promoters on the ZNF497 side of A1BG for

1. ATA boxes 3'-AATAAA-5' occurs at 3427,
2. CArG boxes,
3. Enhancer boxes,
4. HY boxes,
5. MREs and
6. STAT5s 3'-TTCCATGAA-5' occurs at 128.

The HNF6 promoter on the other side of A1BG (at about +3 kb is way beyond -2.1 through ZNF497 unless the DNA is folded to allow the HNF6 on the ZSCAN22 side to be used in analogy to the HNF6 on the same side as in the rat.

HNF6s have a role as downstream signal transducers in A1BG, where the murine downstream promoter element is only 11 nts displaced from the human one. This suggests a HNF6 participation in human gene transcription of A1BG.

HY boxes

HY boxes were not found in either core promoters or the proximal promoters in either direction. However, HY boxes were found in the distal promoters on both sides of A1BG. No genes are described in the literature so far as transcribed from HY boxes in any distal promoters.

Either A1BG can be transcribed by HY boxes in the distal promoter, or A1BG is not transcribed by HY boxes. As the literature appears absent from a Google Scholar advanced search to confirm possible transcription from distal promoters, wet chemistry experiments are needed to test the possibility.

Metal responsive elements (MREs)

By combining a literature search with computer analysis of the promoter between ZSCAN22 and A1BG and ZNF497 and A1BG, metal responsive elements have been found. Literature search has also discovered at least three post-translational isoforms including the unaltered precursor. Although no metal responsive elements overlap any enhancer boxes in the distal promoter, there are elements in the distal promoter.

"The human genome is estimated to contain 700 zinc-finger genes, which perform many key functions, including regulating transcription. [Four] clusters of zinc-finger genes [occur] on human chromosome 19".

Nearby zinc-fingers on chromosome 19 include ZNF497 (GeneID: 162968), ZNF837 (GeneID: 116412), and ZNF8 (GeneID: 7554).

"In rodents and in humans, about one third of the zinc-finger genes carry the Krüppel-associated box (KRAB), a potent repressor of transcription (Margolin et al. 1994), [...]. There are more than 200 KRAB-containing zinc-finger genes in the human genome, about 40% of which reside on chromosome 19 and show a clustered organization suggesting an evolutionary history of duplication events (Dehal et al. 2001)."

ZNF8 is in cluster V along with A1BG.

"In contrast to the four clusters considered [I through IV], one that occurs at the telomere of chromosome 19, which we will call cluster V, has been very stable [over mouse, rat, and human]."

"Apart from the somewhat unexpected location of Zfp35 on mouse chromosome 18 and of the AIBG orthologs on mouse chromosome 15 and rat chromosome 7, there has been little rearrangement."

So far no article has reported any linkage between zinc, including various zinc fingers, or cadmium, and A1BG.

Regarding additional isoforms, mention has been made of "new genetic variants of A1BG."

"Proteomic analysis revealed that [a circulating] set of plasma proteins was α 1 B-glycoprotein (A1BG) and its post-translationally modified isoforms."

Pharmacogenomic variants have been reported. There are A1BG genotypes.

A1BG has a genetic risk score of rs893184.

"A genetic risk score, including rs16982743, rs893184, and rs4525 in F5, was significantly associated with treatment-related adverse cardiovascular outcomes in whites and Hispanics from the INVEST study and in the Nordic Diltiazem study (meta-analysis interaction P=2.39×10⁻⁵)."

"rs893184 causes a histidine (His) to arginine (Arg) [nonsynonymous single nucleotide polymorphism (nsSNP), A (minor) for G (major)] substitution at amino acid position 52 in A1BG."

For example, GeneID: 9 has isoforms: a, b, X1, and X2. Each of these (a and b) have variants. Variants 1-6 and 9 all encode the same isoform (a).

Variants 7, 8 and 10 all encode isoform b. Isoforms X1 and X2 are predicted.

Variants can differ in promoters, untranslated regions, or exons. For GeneID: 9: This variant (1) represents the longest transcript but encodes the shorter isoform (a). This variant is transcribed from a promoter known as P1, promoter 2, or NATb promoter.

This variant (2, also known as Type IID) lacks an alternate exon in the 5' UTR, compared to variant 1. This variant is transcribed from a promoter known as P1, promoter 2, or NATb promoter.

This variant (9, also known as Type IA) has a distinct 5' UTR and represents use of an alternate promoter known as the NATa or P3 promoter, compared to variant 1.

But, A1BG in NCBI Gene lists only one isoform, the gene locus itself, and the protein transcribed is a precursor subject to translational or more likely post-translational modifications.

The presence of multiple MREs coupled with experimental results from the literature indicating post-translational isoforms tends to confirm the existence of two or more isoforms for A1BG.

It isn't known which, if any, assist in locating and affixing the transcription mechanism for A1BG. This examination is the first to test one such DNA-occurring TF: the HNF6s.

The presence of multiple MREs coupled with experimental results from the literature indicating post-translational isoforms tends to confirm the existence of two or more isoforms for A1BG and likely transcription from either side.

STAT5s

STAT5s have a role as downstream signal transducers in A1BG, where the murine downstream promoter element is only 11 nts displaced from the human one. This suggests a STAT5 participation in human gene transcription of A1BG in the proximal promoter downstream between any other promoter and the TSS on the ZNF497 side of A1BG.

A1BG is not transcribed by any STAT5s is clearly disproved by the STAT5 transcription factor in the proximal promoter on the ZNF497 side of A1BG.

STAT5s may assist transcription of A1BG by other transcription factors, literature search has found that STAT5s assist transcription of A1BG by other transcription factors. The proximal STAT5 promoter is -58 to -50 from A1BG TSS. If another STAT5 promoter is at -2.3 kb, it is about -1.4 kb inside ZNF497 which is 3212 nts long. Per analogy to the rat this would be expected. A STAT5 transcription site lies at 3'-TTCCGGGAA-5' at 4247 in the proximal promoter, i.e. from 4242 (-58) to 4250 (-50). This suggests that STAT5 assists in the transcription of A1BG.

TATA boxes

On the negative strand in the negative direction (from ZSCAN22 to A1BG), looking for 3'-TATA-A/T-A-A/T-A/G-5', there no TATA boxes in the core promoter.

On the negative strand in the positive direction (from ZNF497 to A1BG), looking for 3'-TATA-A/T-A-A/T-A/G-5-5', there no TATA boxes in the core promoter.

There are no TATA boxes in the negative direction of the proximal promoter.

There are no TATA boxes in the positive direction of the proximal promoter.

For the positive strand in the negative direction looking for 3'-TATA-A/T-A-A/T-A/G-5', there's one 3'-TATATAAA-5' at 2874 nts, its complement and inverse complement of the distal promoter.

Any TATA boxes before A1BG from the direction of ZN497 may be out to 2300 nts. None were found in the distal promoter.

On the positive strand, in the nucleotide region between gene ZSCAN22 (NCBI GeneID: 342945) and A1BG (NCBI GeneID: 1) are 211 TATA box-like 8 nt long sequences. Of these,

1. TATAAAAG occurs at 58853713 + 183 nts and
2. TATAAAAG at 58853713 + 222. This is a TATA box found with some genes. But, the optimal TBP recognition sequence 3'-TATATAAG-5',> does not occur.
3. TATATAAA occurs only once at 2874 nts from the end of ZSCAN22. TBP is bound to this sequence and TATAAAAG above.
4. TATAAA occurs seven times, with the closest one at 2874 nts from the end of ZSCAN22. "In virtually every RNA polymerase II-transcribed gene examined, the sequence TATAAA was present 25 to 30 nts upstream of the transcription start site."

A1BG does not have a TATA box in the core promoter region. There is the sequence 3'-TGCTATATAGATGGCAACTAAGCACTTGGGGAAAAAA-5' for which the first nt (T) is number 58856598 or 1574 nt upstream from the beginning of the 3'-UTR at 58858172. Unless another variant exists, -1574 nt from the beginning of the 3'-UTR is a large number of nts away from the TSS.

The closest TATA box-like sequence is 3'-CTCTTAAG-5' on the template strand at 4408 nts from the end of ZSCAN22, which is upstream from the core promoter.

The extra TATA boxes between ZSCAN22 and A1BG strongly suggest that there is at least one gene (or pseudogene) between ZSCAN22 and A1BG not currently in the NCBI database.

On the negative strand between ZNF497 and A1BG, there are no TATA boxes of the form 3’-TATA-A/T-A-A/T-A/G-5’.

For the negative strand going from ZSCAN22 to A1BG there are two TATA boxes: 3'-TATATATA-5' at 1600 nts and 3'-TATATAAA-5' at 1602 nts. These are way too far from the possible TSS in this direction.

These two TATA boxs in the distal promoter at approximately -2860 nts from the TSS suggest that there may be a short gene between ZSCAN22 and A1BG.

The hypothesis: TATA boxes are not involved in the transcription of A1BG is true. "In virtually every RNA polymerase II-transcribed gene examined, the sequence TATAAA was present 25 to 30 nts upstream of the transcription start site."

There are no TATA boxes at all between ZNF497 and A1BG.

On the negative strand between ZSCAN22 and A1BG there are many TATA boxes between 184 nts from ZSCAN22 and 2874 nts from ZSCAN22 yet no genes are apparently known to occur between ZSCAN22 and A1BG. ZSCAN22 has several isoforms but all end exactly at the one TSS on the A1BG side.

From the number and variety of TFs on both sides of A1BG, multiple transcriptions should be possible. Any connection between bone, muscle and brain mass loss and A1BG likely uses one or more of the sides, directions, or forms (16 ways) and includes one or more TFs. Determining which produces deleterious effects is the first step toward reversal in a zero-g radiation inducing environment.

Experiments

The Basic programs (starting with SuccessablesCGCG.bas) were written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), looking for CGCG boxes, their possible complements and inverses to test the hypothesis that CGCG boxes are not involved in the transcription of A1BG.

Results

On the negative strand in the negative direction (from ZSCAN22 to A1BG), looking for 3'-(A/C/G)CGCG(C/G/T)-5', there no CGCG boxes in the core promoter.

On the negative strand in the positive direction (from ZNF497 to A1BG), looking for 3'-(A/C/G)CGCG(C/G/T)-5', there no CGCG boxes in the core promoter.

There are no CGCG boxes in the negative direction of the proximal promoter.

There are no CGCG boxes in the positive direction of the other proximal promoter.

There are no CGCG boxes after nucleotide number 2460 in the negative direction of the distal promoter.

There are no CGCG boxes after nucleotide number 2300 in the positive direction of the other distal promoter.

All of the CGCG boxes found are more closely associated with ZSCAN22 or ZNF497 than A1BG.

Discussions

A search of NCBI Gene using ""CGCG box" human" resulted in "No items found." and "Quoted phrase not found."

Calmodulin-binding transcription activator (CAMTA) occurs in human genes: GeneID: 23261 CAMTA1 calmodulin binding transcription activator 1 and GeneID: 23125 CAMTA2 calmodulin binding transcription activator 2.

GeneID: 375611 SLC26A5 solute carrier family 26 member 5 has a response to salicylic acid.

Def. any "process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a salicylic acid stimulus" is called a response to salicylic acid.

That all of the CGCG boxes found are more closely associated with ZSCAN22 or ZNF497 than A1BG suggests that ZSCAN22 and ZNF497 may have a response to salicylic acid.

But, A1BG is not transcribed by CGCG boxes.

Conclusions

A1BG is not transcribed by CGCG boxes.

Laboratory evaluations

Main resources: Judgments/Evaluations and Evaluations

To assess your example, including your justification, analysis and discussion, I will provide such an assessment of my example for comparison and consideration.

Evaluation

No wet chemistry experiments were performed to confirm that Gene ID: 1 may be transcribed from either side using TFs in distal promoters. The NCBI database is generalized, whereas individual human genome testing could demonstrate that A1BG is transcribed from either side TFs. Sufficient nts have been added to the data sets for the ZNF497 side to confirm likely transcription of A1BG.

See also

• Core promoter
• Gene transcriptions/Boxes/CGCGs
• Gene transcriptions/A1BG/Core promoters
• Transcription of A1BG