Jump to content

Biology (A-Level)/Molecules, Cells and Systems

Add links
From Wikiversity

This Course will teach some of the fundamental concepts of cell biology topics which include "DNA,Cell Terminology and structures,Virus's,evolution, Meiosis and Mitosis,And the overall physiology of how the cell works and how we can associate this knowledge with everyday situations". There isn't any complex terminology and this course can easily be taken by anyone with a curiosity into cell biology.

The cell

[edit | edit source]

All life is made up of tiny units called cells.

The two most broadest classification of cells are

  • Prokaryote- without a nucleus(ex. bacteria)
  • Eukaryote- with a nucleus


Cells contain various machinery inside of them called organelles which perform functions for the cell. These organelles are

  • 1) nucleus- which contains the genetic material of the cell[also the site of RNA and DNA activities like replication
  • 2) endoplasmic reticulum- which contains the rough ER(contains ribosomes) and the smooth ER(synthesizes lipids)
  • 3) vacuole- contains nutrients of the cell
  • 5) lysosomes- digestive enzymes
  • 6) vesicles- small body's in the cell
  • 7) Golgi Apparatus- Packager of the cell
  • 8) centrosomes- contain centrioles which aid in mitosis[cell division]
  • 9) cytoskeleteon- organelle that maintains cell shape
  • 10) ribosomes-The ribosomes are a large complex of RNA and protein molecules, This is where proteins are produced


Cell Division

[edit | edit source]

When a cell divides it must go through a process called mitosis. Mitosis is a process that describes the various steps that occur in a cell before and after initial division

The cell cycle as its most commonly called consist of the

  • G1- cell growth begins
  • S- Protein synthesis and chromosomal replication occurs
  • G2- cell now has duplicate copies of chromosomes
  • M Phase- centrioles lock onto each end of the chromosomes and then pull them apart to make two cells


Terms (chromosome - super coiled DNA wounded together with histones)

All of the above is moderated by two molecules called "CDK-Cyclin"


Replication, Transcription, and Translation of DNA+RNA

[edit | edit source]

Transcription


DNA or deoxyribeonucleicacid is the code for life, it contains the instructions for the production of proteins which do various operations in the cell. DNA by nature is a polymer(macromolecule) and consist of four nucleotide bases(adenine,guanine,cytosine,and thymine).It also contains sugar and phosphate groups as a backbone.

There is a general rule in molecule bonds in DNA

A & G are purines C & T are pyrimidines

A--->T(and U if its RNA) & C--->G


DNA is basically the raw code. It is unusable in making proteins until it is coded into something else called "mRNA" mRNA is created when the DNA double helix is unwinded by helicase(an enzyme). afterward stranding RNA nucleotides(AUCG, not T) link with one of the helix's strands, Once mRNA is coded for translation can begin.

if we had a strand of DNA that was [ACGACGACAGACGTTTTCGAGACAGAC] The complementary RNA strand would be [UGCUGCUGUCUGCAAAAGCUCUGUCUG]


Translation

Each three nucleotides counts as a codon or protein coder(ex. are methionine, and lysine)

with our newly coded strand of mRNA we can being translation and produce a fully functional "polypeptide chain" or protein chain. The proteins are located on the ribosomes called tRNA or transport RNA which transports the proteins so they can link up with their complementary mRNA codons

If we had a codon

|GCG||CCG|

the complementary tRNA would be protein1{CGC} + protein2{GGC} = polypeptide chain(ex. hemoglobin)


Replication


When a cell divides, it undergoes a process called mitosis and in the "S" phase of this cycle, DNA replicates, for replication and ultimately mitosis to take place (DNA must replicate). There are certain steps to this process. The first step is that DNA must be unwound by an enzyme called helicase. Afterwards, proteins link with the strands to make sure they don't bond back together. DNA polymerase comes into action next. It supplies complementary nucleotides from DNA 5' to 3' end. The leading strand replicates properly, but the lagging strand does not. It is formed in pieces called Okazaki fragments.


ATP

[edit | edit source]

ATP(adenosinetriphosphate) is an molecule that powers your cells--- not finished

Retrieved from "https://en.wikiversity.org/w/index.php?title=Biology_(A-Level)/Molecules,_Cells_and_Systems&oldid=1605309"