Transcription of A1BG
| Completion status: Ready for testing by learners and teachers. Please begin! |
A1BG is the official symbol for GeneID: 1, "A1BG alpha-1-B glycoprotein [ Homo sapiens ]", in the NCBI Gene database for gene-specific information. To access information about this gene, use the "Home - Gene - NCBI" external link and enter "1[uid]", without the quotes. The official name of this gene is "alpha-1-B glycoprotein"[1]. "The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins."[1]
| Development status: this resource is experimental in nature. |
Transcription of eukaryotic genes is believed to be reasonably well understood. Not all the facts are known but phenomenology is probably complete. Each possibility to cause a simple computer program to transcribe the gene for A1BG is to be tested.
| Educational level: this is a secondary education resource. |
| Educational level: this is a tertiary (university) resource. |
Most undergraduate university courses describe transcription, so many of the terms used here to analyze the transcription should be reasonably understood. Some usage of state-of-the-art refereed journal articles is included.
| Educational level: this is a research resource. |
Although there are computer programs being used to predict the effects of gene expression, up-regulation or down-regulation, most of these are quite advanced and are not readily available for students or researchers outside specific universities or companies performing drug research and testing.
| Resource type: this resource is an article. |
Just about any student with access to a computer in various forms is able to write small programs in a variety of computer languages to test for themselves whether or not a specific algorithm works to transcribe this gene.
| Subject classification: this is a biochemistry resource. |
The transcription start site for A1BG has probably been discovered through the use of reverse transcriptase. The publication demonstrating this has not been found. Further, the product of the gene has been detected, but exactly how the product has its messenger RNA initially transcripted is unspecified and perhaps unknown.
| Subject classification: this is a genetics resource. |
Notation [edit]
Notation: let the symbol Def. indicate that a definition is following.
Notation: let the symbols between [ and ] be replacement for that portion of a quoted text.
Notation: let the symbol / replace or.
For example, (A or C or G) becomes (A/C/G).
Notation: let the following table of International Union of Pure and Applied Chemistry (IUPAC) stand for the nucleotides indicated.
| IUPAC nucleotide code | Base |
|---|---|
| A | Adenine |
| B | C/G/T |
| C | Cytosine |
| D | A/G/T |
| G | Guanine |
| H | A/C/T |
| K | G/T |
| M | A/C |
| N | any base (A/C/G/T) |
| R | A/G |
| S | G/C |
| T | Thymine |
| V | A/C/G |
| W | A/T |
| Y | C/T |
Universals [edit]
To help with definitions, their meanings and intents, there is the learning resource theory of definition.
Def. evidence that demonstrates that a concept is possible is called proof of concept.
The proof-of-concept structure consists of
- background,
- procedures,
- findings, and
- interpretation.[2]
The findings demonstrate a statistically systematic change from the status quo or the control group.
The detection of the gene product presumes that transcription occurs and may suffice as proof of concept.
Def. "the factors, including RNA polymerase II itself, that are minimally essential for transcription in vitro from an isolated core promoter"[3] are called the basal transcription machinery.
RNA polymerase II holoenzyme finds and uses the transcription start site. How?
Immunoglobulin domain [edit]
"The immunoglobulin domain is a type of protein domain that consists of a 2-layer sandwich of between 7 and 9 antiparallel β-strands arranged in two β-sheets with a Greek key topology.[4][5]"[6]
Angiotensin-converting enzyme [edit]
The angiotensin I converting enzyme (ACE) is "involved in catalyzing the conversion of angiotensin I into a physiologically active peptide angiotensin II" and has a "testicular form ... variant (2)".[7]
ACE "plays a key role in the renin-angiotensin system."[7]
"CRISP proteins have been shown to be involved in various functions related to sperm–oocyte fusion, innate host defense function and ion channel blockage."[8]
"Multiple members of the CRISP family have been identified in the mammalian male genital tract (CRISP1, CRISP2 and CRISP3)."[8]
"[T]here is evidence that prostate cancer patients with higher levels of CRISP3 have a smaller probability of recurrence-free outcomes [13]."[9]
A1BG-CRISP3 [edit]
The human cysteine-rich secretory protein (CRISP3) "is present in exocrine secretions and in secretory granules of neutrophilic granulocytes and is believed to play a role in innate immunity."[10] CRISP3 has a relatively high content in human plasma.[10]
"The A1BG-CRISP-3 complex is noncovalent with a 1:1 stoichiometry and is held together by strong electrostatic forces."[10] "Similar [complex formation] between toxins from snake venom and A1BG-like plasma proteins ... inhibits the toxic effect of snake venom metalloproteinases or myotoxins and protects the animal from envenomation."[10]
"Opossums [such as shown at top of the article] have a remarkably robust immune system, and show partial or total immunity to the venom of rattlesnakes, cottonmouths, and other pit vipers.[11][12]"[13]
"Crisp3 [is] mainly [expressed] in the salivary glands, pancreas, and prostate."[14] "CRISP3 is highly expressed in the human cauda epididymidis and ampulla of vas deferens (Udby et al. 2005)."[14]
Overexpression [edit]
Pancreatic juice is "an exceptionally rich source of proteins which are released from pancreatic cells in the physiological state".[15] Matrix metalloproteinase-9 (MMP-9), A1BG, and oncogene DJ-1 occur in the pancreatic cancer juice.[15] "MMP-9, DJ-1 and A1BG [are] positively expressed in 82.4%, 72.5% and 86.3% of pancreatic cancer tissues, significantly higher than that in normal pancreas tissues."[15]
Genomic context [edit]
Shown on the top diagram is the genomic context of A1BG as of 2010. The gene is overlapped by a non-coding RNA (NCRNA00181), and has nearby genes ZSCAN22 at the 5' end and ZNF497 (GeneID: 162968) at the 3' end. The nucleotides between genes ZSCAN22 (GeneID: 342945) and the 5'-end of A1BG, should contain the A1BG promoter. NCRNA00181, which overlaps A1BG, has numbered nucleotides 58863336 to 58866548.
In the lower diagram NCRNA00181 has undergone a name change to A1BG antisense RNA 1 (A1BG-AS1), GeneID: 503538.
Genomic product [edit]
As indicated in the diagram above, there are eight exons (red rectangles) and seven introns (red lines) between the 5' untranslated region (UTR, 5'-UTR) and the 3'-UTR.
When A1BG is transcribed by the RNA polymerase II holoenzyme, the pre-mRNA (messenger RNA, mRNA) consists of eight exons and seven introns which are spliced to yield the final mRNA. A1BG is a minus strand transcription. The included nucleotides as numbered in the human genome go from 3'-58858172 to 58864864-5' inclusive and are so transcribed. When the mRNA template 5'-58858172 to 58864864-3' is used to create the protein, the translation proceeds 3'-58864864 to 58858172-5' rather than 5'-58858172 to 58864864-3'.
Eukaryotic transcription [edit]
Eukaryotes have a double helix of DNA surrounded by an epigenome.
"[A] single strand of DNA [has a positive sense (+)] if an RNA version of the same sequence is translated or translatable into protein. Its complementary strand is called antisense (or negative (-) sense)."[16]
"The two complementary strands of double-stranded DNA (dsDNA) are usually differentiated as the "sense" strand and the "antisense" strand. ... [T]he DNA antisense strand ... serves as the source for the protein code, because, with bases complementary to the DNA sense strand, it is used as a template for the mRNA."[16]
"The only real biological information that is important for labeling strands is the location of the 5' phosphate group and the 3' hydroxyl group because these ends determine the direction of transcription and translation."[16]
From a molecular point of view, a transcription complex may not have an obvious way to choose the "antisense" strand from the "sense" strand. It also may not have an obvious way to chose the direction of transcription once a strand has been chosen as the "antisense" strand.
To choose which strand, then which direction, may require chemical cues. A1BG has two sections of nucleotides between itself and neighboring genes:
- between ZSCAN22 and A1BG and
- between ZNF497 and A1BG.
The NCBI gene database conveniently labels the genomic context with increasing nucleotide numbers in the direction of transcription 3'-5' on the template strand. When viewing the genomic regions, transcripts, and products under tools, click on "Sequence Text View". The database informs you which strand you are looking at (negative strand) or by "Flip Strands" the (positive strand).
Eukaryotic transcription of the A1BG "protein-coding gene is preceded by ...
- decondensation of the locus,
- nucleosome remodeling,
- histone modifications,
- binding of transcriptional activators and coactivators to enhancers and promoters, and
- recruitment of the basal transcription machinery to the core promoter."[3]
Preinitiation complex [edit]
"A stable preinitiation complex can form in vitro on TATA-dependent core promoters by association of the basal factors in the following order: TFIID/TFIIA, TFIIB, RNA polymerase II/TFIIF, TFIIE, and then TFIIH."[3]
Promoter [edit]
The A1BG promoter is a region of the DNA adjacent to the gene itself that facilitates transcription. Within the overall promoter are response elements which provide a secure initial binding site for the RNA polyermase II holoenzyme.
Positions in the promoter are designated relative to the transcription start site (N+1, TSS), with positions upstream having negative numbers counting back from -1 away from the TSS, for example, -100 is 100 nucleotides (nts) before 3'-58858172 (specifically pre-3' at 58858072).
Distal promoter [edit]
A distal promoter is a portion of the promoter for a particular gene. This distal sequence upstream of the gene is a region of DNA that may contain additional regulatory elements, often with a weaker influence than the proximal promoter.
"[T]he distal promoter ... can range several thousands of nucleotides upstream of the TSS and contains additional regulatory elements called enhancers and silencers."[17]
E box [edit]
"An E-box (Enhancer Box) is a DNA sequence which usually lies upstream of a gene in a promoter region. It is a transcription factor binding site where the specific sequence of DNA, CANNTG, is recognized by proteins that can bind to it to help initiate its transcription. Once transcription factors bind to promoters, they allow for association of other enzymes which will copy the DNA into mRNA. The consensus sequence for the E-box element is CANNTG, with a palindromic canonical sequence of CACGTG.[18] Transcription factors containing the basic helix-loop-helix protein structural motif typically bind to E-boxes or related variant sequences and enhance transcription of the downstream gene."[19]
Proximal promoter [edit]
A 'proximal promoter' is a proximal sequence upstream of the gene, specifically the transcription start site (TSS) of the gene, that tends to contain primary regulatory elements. It is approximately 250 nucleotides (nts) upstream (signified by a negative sign before the number of nucleotides, eg. -250 nts) of the TSS and has specific transcription factor binding sites.
"[T]he proximal promoter [is] a region containing several regulatory elements, which ranges up to a few hundred nucleotides upstream of the TSS"[17].
Metal responsive element [edit]
"[T]hree potential metal response elements (MREs) [overlap] the E-boxes in the repeats, (TGCACGT with TGCRCNC being the consensus sequence; 17,18)."[20]
The reproducible consensus sequence seems to be 3'-TGCRCNC-5', specifically 3'-TGC-(A/G)-C-(A/C/G/T)-C-5'.
Core promoter [edit]
The core promoter is "the minimal portion of the promoter required to properly initiate transcription.[3]"[22] The core promoter is approximately -34 nts upstream from the TSS. "Several factors have been identified that bind to core promoters (reviewed in Smale, 1997)".[23][24]
GC content [edit]
Approximately “76% of human core promoters lack TATA-like elements, have a high GC content, and are enriched in Sp1 binding sites.”[25] The core promoter for A1BG does not have a high GC content.
"CpG islands typically occur at or near the transcription start site of genes, particularly housekeeping genes, in vertebrates.[26]" from the Wikipedia entry about the CpG island.
The number of CG or GC pairs near the TSS for A1BG appears to be low (closer to ~6 % rather than ~60 %).
eIF4E basal element [edit]
HY box [edit]
CAAT box [edit]
On the template strand, the CAAT box consensus sequence is 3'-(C/T)(A/G)(A/G)CCAATC(A/G)-5'.
GC box [edit]
"A GC box sequence, one of the most common regulatory DNA elements of eukaryotic genes, is recognized by the Spl transcription factor; its consensus sequence is represented as 5'-G/T G/A GGCG G/T G/A G/A C/T-3' [or 5′-KRGGCGKRRY-3′] (Briggs et al., 1986)."[27]
B recognition element [edit]
Consensus sequence on the template strand for the B recognition element is 3'-G/C-G/C-G/A-C-G-C-C-5'.
The consensus sequence is 5’-G/C G/C G/A C G C C-3’.[28]
The general consensus sequence using degenerate nucleotides is 5’-SSRCGCC-3’, where S = G or C and R = A or G.[25]
TATA box [edit]
Downstream TFIIB recognition element [edit]
The downstream TFIIB recognition element (dBRE) has a consensus sequence in the transcription direction on the template strand of 3'-RTDKKKK-5', using degenerate nucleotides, or 3'-A/G-T-A/G/T-G/T-G/T-G/T-G/T-5'.[29]
dBRE is cis-TATA box, between the TATA box and the Inr or transcription start site (TSS) and trans-TSS.[29]
X core promoter element 1 [edit]
Motif ten element [edit]
GAAC element [edit]
Initiator element [edit]
"RNA pol II itself recognizes features of the Inr which might assist the correct positioning of the polymerase on the promoter (Carcamo et al., 1991; Weis and Reinberg, 1997)."[23][30][31]
"[T]he initiator (INR) element located at, or immediately adjacent to, the TSS, ... is recognized by the TBP-associated factors TAF1 and TAF2 of the TFIID complex"[25] "[T]wo [non-Inr] motifs - M3 (SCGGAAGY) and M22 (TGCGCANK) - ... occur preferentially in human TATA-less core promoters."[25]
"[T]ranscription does not need to begin at the +1 nucleotide for the Inr to function. RNA polymerase II has been redirected to alternative start sites by reducing ATP concentrations within a nuclear extract, by altering the spacing between the TATA and Inr in a promoter containing both elements, and by dinucleotide initiation strategies"[3].
The wider consensus sequence of 3'-YYRNWYY-5' allows a G at the TSS but at most only allows two Gs in a row.[32]
The "sharp difference in the specificity of the Inr consensus between Drosophila and mammals suggests that mammalian transcription factors have evolved to function with a broader range of Inr sequences than Drosophila transcription factors. This property may be related to the prevalence of dispersed core promoters in mammals but not in Drosophila."[32]
Angiotensinogen core promoter element [edit]
The AGCE1 is supposed to occur before the TSS.[33]
Downstream core element [edit]
The downstream core element (DCE) is a transcription core promoter sequence that is within the transcribed portion of a gene.
The consensus sequence for the DCE is CTTC...CTGT...AGC.[34] These three consensus elements are referred to as subelements: "SI is CTTC, SII is CTGT, and SIII is AGC."[34]
The number of nucleotides between each subelement can apparently vary down to none.
A core promoter that contains all three subelements may be much less common than one containing only one or two.[34] "SI resides approximately from +6 to +11, SII from +16 to +21, and SIII from +30 to +34."[34]
SI as 3'-CTTC-5' can occur as 3 of 4 (CTT, TTC) or 4 of 4 (CTTC). SII as 3'-CTGT-5' can also occur as 3 of 4 (CTG, TGT) or 4 of 4 (CTGT). SIII as AGC is not known to vary.
DCE SIII can function independently of SI and SII.[34]
Downstream promoter element [edit]
"[T]he core sequence of the DPE is located at precisely +28 to +32 relative to the A+1 nucleotide in the Inr"[3]. It is located about 28–33 nucleotides downstream of the transcription start site.[35]
Nucleotides between genes [edit]
A1BG is on chromosome 19 between the genes for ZSCAN22 and ZNF497. Before each untranslated region are nucleotides between the genes.
Between ZNF497 and A1BG are 1006 nts before the TSS from this direction. Between ZSCAN22 and A1BG there are 4618 nts.
Depending on which direction the RNA polymerase II holoenzyme transcribes from is the exact nt of the transcription start site (TSS). For transcription from the ZNF497 direction the TSS sits among the local nts as follows: TTGG+1GGC. For transcription from the ZSCAN22 direction, the TSS sits among TGAA+1ACT.
NCBI at the National Institutes of Health includes these in between nucleotides as well as those for each gene. NCBI has predetermined whether the strand is the coding strand (positive strand) or the template strand (negative strand).
The nucleotides between ZNF497 and A1BG as A1BG is approached from ZNF497 on the negative strand are 3'-58865723:
TGAGTGGGGAGGATGCAGTGCAGGGGGCAGATGAGGGCTAGGCGGTTGCCCTGGGCCCTCACACT CGTAGCGGAGCTAGGCTGGGACACCCAGGGTGGGGACCAGACCTCCCCGGGTGGGAATGACAGGA TGTCCATGGAGGCTGAGTGTGAAAGCACCACGGTCTCACCCCTGTCCTGTTCCATCCCAACAGGCT GTGGTGAGGAGAGGGGGAGGCAGGGGAAGCGGGAGGCCTGGCCTCCAGGCAGCAGGCTATAGCCA CATGAGTGACCACCAGCAGCTCAGGTAACTGAGCACATGTCACGGGTAGGCCTGGGAAGCGCAGG TCTCAGCTGAATGACCTGGGTGGAAATCCGACTCCAGAGCCGTGGTGGGTCACACCATGCAGAATG AACCAGTGATGGAGAAGGAACCACAGTCCTCAGGAAGAGTGAGGGTGCACCTCCAGACAGCCCAT GTGAGGGCAACCGCAGAAAGTCTGAAAAGAGGTGAACCCCACCTTTGGTGTCACATGTGCAGTGTG GTGTGACAGGGAGGGGCTCGCTGGGCTTCAGCCCCGGCACTCTCCACTTGACCTCAGCAGCTCCAG GTAGAGTGGGGAGAACTCAGCGTCTCCTTCTAGAACAGGTTCTAGGATCCATCACTGAAATGAGGA TGAGGTGGTTTTAACATCATTTTATCACTCTTGATTTAGTTTATTAATCATACATGATTATTGATTAT AATTGTTGCTGGGCATCCTGAGGCCTCAGAAGTTCACCCTTTGCCCTGACCCCATGGGGGCCCTGC CCCCGCCTTCCGGGAAGGACAAACACGGGAAGAGGTCAGTGCCCGAGCCACCCCACCGCCCTCCC TTGG+1 :58864973-5'.
The nucleotides between ZSCAN22 and A1BG as A1BG is approached from ZSCAN22 on the negative strand are 3'-58853715:
TTTAAGATTGTCTGACTTAAAGAAAAACCTGGTCGGTATACAAGAAATCTTTTCTATGTGGATTTTG TTCCTATACCCTTCAACTCCCGTTTCCCTATCTTTTCCTATATGTTCCATCCGTACTTTGACTTCTTT CGACTACCTCGACGTAATCAGCGCGTTTTGTCTGTAATTCCATATTTTCGTAAAATTCTTAGTACCC CAGTGATACAAAAATATTTTCTTTGTTAGATAATCCTTCTACATTATCAAGTTTTGGTCCGTGTATT ATACTCAGAACATCTTGTCTTAGTGTCACTCTTTGACTGCTTTGGAATTCACATGAACCTTCACGAT TGTGCAAGAAATACTATCTTTTGTAAACTTCTCCGGCCCACGCCACCGAGGGTGGACATTAGGGTC GTGAAACCCTCCGGTTCTGTCCGCCTAGTGCTCCAGTCCTCACGCTCCGTTCGGACCCGTTGTATC ACTTTGACAGATGTTTTTTATGCTTTTAATCGGTCGGACCCGGCCCGTGTCACCTAGTGTGCATTAA GGTCGTGAAACCCTCCGGTTCTGTCCGTCCAGTGCTCCAGTCCTCTAACTCTAGTAGGACCGATTA TACCACACATTGGGGAAGAGATGATTTTTATGTTTTTTAACCGGTCCGTGCCACCGAGTGCGGACA TTAGGGTCGTGAAACCCTCCGGTTCCGTCCGCCTAGTGCTCCAGTCCTCAAGCTCTGGTCGGACTG GTCGCACCACTGTGGGGCAGAGATGATTTTTATGTTTTTTAATCGACCTACACCACCACACATGGAC ATTAGGGTCGATGATTCCTCCGACTCCGTCCTCTTAGCGAACTTGGGTCCTCCGCCTCCAACGCCA CTCGGTTCTAGTGTGGTAACGCGAGGTCGGACCCGTTGTCTCGCTCTGAGACAGAGTTTTTTTTTTT TTTTTTTTTCGGTCCGTACCGCCGTGTGCGGACATCTAGGTCGATTAGTCCTCCGACTCCGTCCTCT TAACGAACTTGGACCCTCCGTCTCCAACGTCACTCGGCTCTAACCCACTGAAGTGAGGTCGGAGCT GTTGTCTCACTCTGAGACAGAGTTTTTTTTTTTTTTTTTCCGACCCGTGTCACCGAGTGTGGACATT AGGGTCGTGAAACCCTGCGGCTCCACCCACCTAGTGGACTCAAGTGCTCAAACGCTGGTCGGACCG GTTGTACCACTTTGGGGCACAGATGTTTTTTAATCGGCCCGCACCACCGCCCACGGACATTAGGGT CGATGAGTCCTCCGACTCCGTCCTCTTAATGAACTTGGATCCTCCGTCTCCAACGTCACTCGGCTC TAACGTGGTAACGTGAGGTCAGACCCGTTATTCTCGTTTTGAGGTAAAGTTTTTGTTTGTTTTTTTT CTGAGTTGGGTCTTAAGAAAAAAAAAAAAAAAAACTCTACCTCAGAGCGAGACAACGGGTCCGACC TCACGTCACCACACTAGAGTCGAGTGACGTTCGAGGCGGAGGGCAGTTGGGTCTTAAGATATAGGT CACGTTTGTGTGAATTTCTTGCTTCCGTTTTATGTCTGTAGGAGTTTACTTTGTTTGGATTCTATATA TAAAGAACGGTCGTCTGAACGGACTTTTCTTTACGGTTTCCTTTGAGAACCATCTTCCCTTTACTAT GGTCTCCCTTTCGCCCTTGAAACCCTTAATTTACTATCATTATCTCTAACGTGTTAATAAAATAGAA ATTTTATACCGACCTCCGCCGACCCGCGCCACCGAGTGCAGACATTAGGGTCGTGAAACCCTCCGA CTCCACCCGCCTAGGGTTCCCGTCCTCTACCTCTGGTAGGACCGATTGTACAACTTTGGGGTAGAG ATGATTTTTATGTTTTTTTAATCGACCCGCACCACCACCCGAGGACATTAGGGTCGATGAACCCTCT GACTCCGTCCTCTTACCGTACTTGGACCCTCCGTCTCGAACGTCACTCGGCTCTAGTGCGGTGACG TGAGGTCGGACCCGCTGTCTCGTTCTGAGACAGAGTTTTTTTTTTTTTTTTTTTCTTTTTTTTACACC GACCTCCGGTCCACGTCACATTAGGATCGTGAAACCCTCCGACTCCACCTGTCTGGTGAACTCGAG TCCTCAAACTCTGGTTGTACCGCTTTATGACAGAGATGATTTCTATGTTTTTTACTGGCCCACGCCA CCGAGTGCGGTCATGAAACCCTCCGACTCCGCCAACCCTAGTGTTCCAGTCCTCAAACTCTGGTCG GACCTGTCGTACCACTTTGGGGTAGAGATGATTTTTATGTTTTTTGATCGGCCCGTACGACCACCCA CGGACATCATGGTCGATGAGGCCTCCGACTCCGTCCTCTTAACGAACTTGGACCGTCCGCCTCCAA CGTCACTCGGCTCTAGTGTGGTGACGTGAGGTCGGACCCGTTGTCTCACTCTAAGCCCTTTTTTTTT TTTTTTCGTTTTCGTTTGTTTGTTTTGAGTTATCATTCTTTTGTTTGTCCGGTCCGTGCCACCGAGTA CGGACATCAGGGTTGTGAAACCTTCCGACTCCGTCCACCTAGTGAACTCCAGTCCTCAACTTCTGG TCACACCGGTTGTACCACTTTGGGGGAGAGGTGATTTATATGTTTTTAGTCGGTCACACCACCGTG TACGGACATTAGGGTCGATGTGTCCTCCGACTCCCTCAACTTAGCGAACTTGGACCCGCCGCCTTC AACGTCACTCGACTTTAGTACGGTGACGTGGGGTCGGACCCGTTGTCTCGTACTGAGAGAGTTTTT CTTTCTTTTCTCTTCTTTTTTCTTTTCTCTTCTTTTTTCTTTTGTTGGGTTATAAAATTTCACACGTTT TATATATTTGTCTGTAAAGTAGTTTCTACGATATATCTACCGTTGATTCGTGAACCCCTTTTTTACGA ATTGTAGTAGTCTGTAATTCCTTTGCGTTCCTTTTGGTGATAATCTATACAGATGTATGGATAATCT TACCGATTTTATTTGAAAAATTTTTTGATTCGACCCCGACCCGCACCACCGAGTGGGGACATTAGGG TCGTGAAACCCTCCGACTCCGCCCACCTAGTGAACTCGAGTCCTCAACCTCTGGTCGGACCGGTGG GTTGTTCCACTTTGGGGTAGAGATGATTTTTGTATTTTTAATCGACCCACACCACCACCCACGGACA GTCGGGTCGATGAGTCCTCCGACTCCGTGCTCTTAGTGAACTTGGGTCCTCCATCTCCAACGACAC TCGGTTCTAGTGCGGTAACGTGAGGTCGGACCCGTTGTTCTCGTTTTAAGACAGAGTTTTTGTTTAT TTGTTCTTTTCCAAAATTTTTAACTATTTGGTGATCGTTCTTTCTCTCTCTCCTGTGTAGTCCGAACT CTCTTCACTGTAGTAGTATCTGACACGTCTGTAATTTTCCGTATCCGTATAATCCTTGATCTATAAT GATTCCGTCATTTGGTCTAGTGATCGTTTAAGCAACTTTTTGTGTTAAGTAGTTGATAACCAACTAT TATGACTATGCGTAGAAGACACACGGTCCCGGAACTCCGGGACGAGGTCCGTCTTTGAGCCGTCAC CAACCCTTCCGTAGTCTACAGTCTACCGTGTTCTCCTGAGTCTCGACTCCCTATTACCCTTTCTTGT GTCTCCTTAGGTCGGTAAAGGTGTCGCAGGTCGAGACGACACCCTCCGACCCTTGTCGGGTCGTGA TGGTGGGACCTGACCCTCCTGTTCTGGTGTTTTACGTCGAAGGGACTTGGAGGAGAACCACTACCC CAACTACACCAGCTCCATCTCCACTCATACAGACCTCGGAGTTCGTTGACGGGTATGGACGACCCT GGTCCGGCTCCACGGGTCCCTCATTCTCCGTCGTAGGACCTTCTCGTGTCTACTTTCTCCGGGACT CTTCACAACCAACCGGTCCACGACACCGAGTGTGGACATTAGGGTTGTGAAACCCTCCGACTCCGC CCTCCTAGTGAACTCGGGTTCTCAAGTTCTGGTCGGACCCGTTGTATCACTCTGAGTAGAGATGTT TTTTATTTATTATCTTTCTTTTTACACTCAACCGGTCCGTACCACCGAGTACGGACATCAGGGTCGA TGAGTCCTCCGACTCCACCCTCCTAGTGAATTCCGGTCCTCAAGTTCTGTTCGAACCCGTTGTGTCA CTCTGGGACAGATGTTTTTTATTATTAATCGGTCTGCACCGCTACGTACGGGTCCGAGGGTCGATG AACCCTCCGACTCCGTCCTCCTAGCGAACTCGGACCCTCCAGTTTTGACGTCACTCGGCCTGACGT TGTGACGTGAGGTCGGACCCACTGTCACACTCTGGGACAGAGTTTTTTCTTTTTTCTTTTCTTTTGA CACGAGAATTCTCGGTCAAGAGGTGAGGAGATGGAGTCCTCGGTGGGGTCTTGGGTAGGTGAA+1 :58858175-5'.
The nucleotides between ZNF497 and A1BG as A1BG is approached from ZNF497 on the positive strand are 3'-58865723:
ACTCACCCCTCCTACGTCACGTCCCCCGTCTACTCCCGATCCGCCAACGGGACCCGGGAGTGTGAG CATCGCCTCGATCCGACCCTGTGGGTCCCACCCCTGGTCTGGAGGGGCCCACCCTTACTGTCCTAC AGGTACCTCCGACTCACACTTTCGTGGTGCCAGAGTGGGGACAGGACAAGGTAGGGTTGTCCGACA CCACTCCTCTCCCCCTCCGTCCCCTTCGCCCTCCGGACCGGAGGTCCGTCGTCCGATATCGGTGTA CTCACTGGTGGTCGTCGAGTCCATTGACTCGTGTACAGTGCCCATCCGGACCCTTCGCGTCCAGAG TCGACTTACTGGACCCACCTTTAGGCTGAGGTCTCGGCACCACCCAGTGTGGTACGTCTTACTTGGT CACTACCTCTTCCTTGGTGTCAGGAGTCCTTCTCACTCCCACGTGGAGGTCTGTCGGGTACACTCCC GTTGGCGTCTTTCAGACTTTTCTCCACTTGGGGTGGAAACCACAGTGTACACGTCACACCACACTGT CCCTCCCCGAGCGACCCGAAGTCGGGGCCGTGAGAGGTGAACTGGAGTCGTCGAGGTCCATCTCAC CCCTCTTGAGTCGCAGAGGAAGATCTTGTCCAAGATCCTAGGTAGTGACTTTACTCCTACTCCACCA AAATTGTAGTAAAATAGTGAGAACTAAATCAAATAATTAGTATGTACTAATAACTAATATTAACAAC GACCCGTAGGACTCCGGAGTCTTCAAGTGGGAAACGGGACTGGGGTACCCCCGGGACGGGGGCGG AAGGCCCTTCCTGTTTGTGCCCTTCTCCAGTCACGGGCTCGGTGGGGTGGCGGGAGGGAACC+1 :58864973-5'.
The nucleotides between ZSCAN22 and A1BG as A1BG is approached from ZSCAN22 on the positive strand are 3'-58853715:
AAATTCTAACAGACTGAATTTCTTTTTGGACCAGCCATATGTTCTTTAGAAAAGATACACCTAAAAC AAGGATATGGGAAGTTGAGGGCAAAGGGATAGAAAAGGATATACAAGGTAGGCATGAAACTGAAGA AAGCTGATGGAGCTGCATTAGTCGCGCAAAACAGACATTAAGGTATAAAAGCATTTTAAGAATCAT GGGGTCACTATGTTTTTATAAAAGAAACAATCTATTAGGAAGATGTAATAGTTCAAAACCAGGCACA TAATATGAGTCTTGTAGAACAGAATCACAGTGAGAAACTGACGAAACCTTAAGTGTACTTGGAAGTG CTAACACGTTCTTTATGATAGAAAACATTTGAAGAGGCCGGGTGCGGTGGCTCCCACCTGTAATCC CAGCACTTTGGGAGGCCAAGACAGGCGGATCACGAGGTCAGGAGTGCGAGGCAAGCCTGGGCAAC ATAGTGAAACTGTCTACAAAAAATACGAAAATTAGCCAGCCTGGGCCGGGCACAGTGGATCACACG TAATTCCAGCACTTTGGGAGGCCAAGACAGGCAGGTCACGAGGTCAGGAGATTGAGATCATCCTGG CTAATATGGTGTGTAACCCCTTCTCTACTAAAAATACAAAAAATTGGCCAGGCACGGTGGCTCACGC CTGTAATCCCAGCACTTTGGGAGGCCAAGGCAGGCGGATCACGAGGTCAGGAGTTCGAGACCAGCC TGACCAGCGTGGTGACACCCCGTCTCTACTAAAAATACAAAAAATTAGCTGGATGTGGTGGTGTGT ACCTGTAATCCCAGCTACTAAGGAGGCTGAGGCAGGAGAATCGCTTGAACCCAGGAGGCGGAGGTT GCGGTGAGCCAAGATCACACCATTGCGCTCCAGCCTGGGCAACAGAGCGAGACTCTGTCTCAAAAA AAAAAAAAAAAAAAAGCCAGGCATGGCGGCACACGCCTGTAGATCCAGCTAATCAGGAGGCTGAGG CAGGAGAATTGCTTGAACCTGGGAGGCAGAGGTTGCAGTGAGCCGAGATTGGGTGACTTCACTCCA GCCTCGACAACAGAGTGAGACTCTGTCTCAAAAAAAAAAAAAAAAAGGCTGGGCACAGTGGCTCAC ACCTGTAATCCCAGCACTTTGGGACGCCGAGGTGGGTGGATCACCTGAGTTCACGAGTTTGCGACC AGCCTGGCCAACATGGTGAAACCCCGTGTCTACAAAAAATTAGCCGGGCGTGGTGGCGGGTGCCTG TAATCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATTACTTGAACCTAGGAGGCAGAGGTTGCAGT GAGCCGAGATTGCACCATTGCACTCCAGTCTGGGCAATAAGAGCAAAACTCCATTTCAAAAACAAA CAAAAAAAAGACTCAACCCAGAATTCTTTTTTTTTTTTTTTTTGAGATGGAGTCTCGCTCTGTTGCCC AGGCTGGAGTGCAGTGGTGTGATCTCAGCTCACTGCAAGCTCCGCCTCCCGTCAACCCAGAATTCT ATATCCAGTGCAAACACACTTAAAGAACGAAGGCAAAATACAGACATCCTCAAATGAAACAAACCT AAGATATATATTTCTTGCCAGCAGACTTGCCTGAAAAGAAATGCCAAAGGAAACTCTTGGTAGAAGG GAAATGATACCAGAGGGAAAGCGGGAACTTTGGGAATTAAATGATAGTAATAGAGATTGCACAATT ATTTTATCTTTAAAATATGGCTGGAGGCGGCTGGGCGCGGTGGCTCACGTCTGTAATCCCAGCACT TTGGGAGGCTGAGGTGGGCGGATCCCAAGGGCAGGAGATGGAGACCATCCTGGCTAACATGTTGAA ACCCCATCTCTACTAAAAATACAAAAAAATTAGCTGGGCGTGGTGGTGGGCTCCTGTAATCCCAGC TACTTGGGAGACTGAGGCAGGAGAATGGCATGAACCTGGGAGGCAGAGCTTGCAGTGAGCCGAGA TCACGCCACTGCACTCCAGCCTGGGCGACAGAGCAAGACTCTGTCTCAAAAAAAAAAAAAAAAAAA GAAAAAAAATGTGGCTGGAGGCCAGGTGCAGTGTAATCCTAGCACTTTGGGAGGCTGAGGTGGACA GACCACTTGAGCTCAGGAGTTTGAGACCAACATGGCGAAATACTGTCTCTACTAAAGATACAAAAA ATGACCGGGTGCGGTGGCTCACGCCAGTACTTTGGGAGGCTGAGGCGGTTGGGATCACAAGGTCAG GAGTTTGAGACCAGCCTGGACAGCATGGTGAAACCCCATCTCTACTAAAAATACAAAAAACTAGCC GGGCATGCTGGTGGGTGCCTGTAGTACCAGCTACTCCGGAGGCTGAGGCAGGAGAATTGCTTGAAC CTGGCAGGCGGAGGTTGCAGTGAGCCGAGATCACACCACTGCACTCCAGCCTGGGCAACAGAGTG AGATTCGGGAAAAAAAAAAAAAAAGCAAAAGCAAACAAACAAAACTCAATAGTAAGAAAACAAACA GGCCAGGCACGGTGGCTCATGCCTGTAGTCCCAACACTTTGGAAGGCTGAGGCAGGTGGATCACTT GAGGTCAGGAGTTGAAGACCAGTGTGGCCAACATGGTGAAACCCCCTCTCCACTAAATATACAAAA ATCAGCCAGTGTGGTGGCACATGCCTGTAATCCCAGCTACACAGGAGGCTGAGGGAGTTGAATCGC TTGAACCTGGGCGGCGGAAGTTGCAGTGAGCTGAAATCATGCCACTGCACCCCAGCCTGGGCAACA GAGCATGACTCTCTCAAAAAGAAAGAAAAGAGAAGAAAAAAGAAAAGAGAAGAAAAAAGAAAACAA CCCAATATTTTAAAGTGTGCAAAATATATAAACAGACATTTCATCAAAGATGCTATATAGATGGCAA CTAAGCACTTGGGGAAAAAATGCTTAACATCATCAGACATTAAGGAAACGCAAGGAAAACCACTAT TAGATATGTCTACATACCTATTAGAATGGCTAAAATAAACTTTTTAAAAAACTAAGCTGGGGCTGGG CGTGGTGGCTCACCCCTGTAATCCCAGCACTTTGGGAGGCTGAGGCGGGTGGATCACTTGAGCTCA GGAGTTGGAGACCAGCCTGGCCACCCAACAAGGTGAAACCCCATCTCTACTAAAAACATAAAAATT AGCTGGGTGTGGTGGTGGGTGCCTGTCAGCCCAGCTACTCAGGAGGCTGAGGCACGAGAATCACTT GAACCCAGGAGGTAGAGGTTGCTGTGAGCCAAGATCACGCCATTGCACTCCAGCCTGGGCAACAAG AGCAAAATTCTGTCTCAAAAACAAATAAACAAGAAAAGGTTTTAAAAATTGATAAACCACTAGCAAG AAAGAGAGAGAGGACACATCAGGCTTGAGAGAAGTGACATCATCATAGACTGTGCAGACATTAAAA GGCATAGGCATATTAGGAACTAGATATTACTAAGGCAGTAAACCAGATCACTAGCAAATTCGTTGAA AAACACAATTCATCAACTATTGGTTGATAATACTGATACGCATCTTCTGTGTGCCAGGGCCTTGAGG CCCTGCTCCAGGCAGAAACTCGGCAGTGGTTGGGAAGGCATCAGATGTCAGATGGCACAAGAGGAC TCAGAGCTGAGGGATAATGGGAAAGAACACAGAGGAATCCAGCCATTTCCACAGCGTCCAGCTCTG CTGTGGGAGGCTGGGAACAGCCCAGCACTACCACCCTGGACTGGGAGGACAAGACCACAAAATGCA GCTTCCCTGAACCTCCTCTTGGTGATGGGGTTGATGTGGTCGAGGTAGAGGTGAGTATGTCTGGAG CCTCAAGCAACTGCCCATACCTGCTGGGACCAGGCCGAGGTGCCCAGGGAGTAAGAGGCAGCATC CTGGAAGAGCACAGATGAAAGAGGCCCTGAGAAGTGTTGGTTGGCCAGGTGCTGTGGCTCACACCT GTAATCCCAACACTTTGGGAGGCTGAGGCGGGAGGATCACTTGAGCCCAAGAGTTCAAGACCAGCC TGGGCAACATAGTGAGACTCATCTCTACAAAAAATAAATAATAGAAAGAAAAATGTGAGTTGGCCA GGCATGGTGGCTCATGCCTGTAGTCCCAGCTACTCAGGAGGCTGAGGTGGGAGGATCACTTAAGGC CAGGAGTTCAAGACAAGCTTGGGCAACACAGTGAGACCCTGTCTACAAAAAATAATAATTAGCCAG ACGTGGCGATGCATGCCCAGGCTCCCAGCTACTTGGGAGGCTGAGGCAGGAGGATCGCTTGAGCCT GGGAGGTCAAAACTGCAGTGAGCCGGACTGCAACACTGCACTCCAGCCTGGGTGACAGTGTGAGAC CCTGTCTCAAAAAAGAAAAAAGAAAAGAAAACTGTGCTCTTAAGAGCCAGTTCTCCACTCCTCTACC TCAGGAGCCACCCCAGAACCCATCCACTT+1 :58858175-5'.
According to one source, A1BG is transcribed from the direction of ZNF497: 3' - 58864890: CGAGCCACCCCACCGCCCTCCCTTGG+1GGCCTCATTGCTGCAGACGCTCACCCCAG ACACTCACTGCACCGGAGTGAGCGCGACCATCATG : 58866601-5',[36] where the second 'G' at left of four Gs in a row is the TSS.[37]
To obtain the nts between genes as well as the first several nucleotides within the first UTR, input the GeneID followed by [uid]. Under "Genomic context" in parentheses is (58858172..58864865, complement). These are the nucleotide numbers on the chromosome. The nearest neighboring gene ZNF497 has (58865723..58874214), where 58864801 to 58866601 (see above) are the nucleotides between the genes that contain the promoter for A1BG.
Transcription start site [edit]
Notation: let the symbol PPP denote a promoter prediction program.
Notation: let the symbol CpG stand for cytosine - phosphodiester bond - guanine, which indicates that C and G are next to each other on the same DNA strand connected by phosphate.
"One important question is what the different PPPs are actually trying to predict. Some programs aim to predict the exact location of the promoter region of known protein-coding genes, while others focus on finding the transcription start site (TSS)."[38] "Recent research has shown that there is often no single TSS, but rather a whole transcription start region (TSR) containing multiple TSSs that are used at different frequencies (Frith et al., 2008)."[38] "The most recent large-scale validation of PPPs included more programs than any of the earlier studies and introduced for the first time an evaluation based on all experimentally determined TSSs in the human genome (Abeel et al., 2008a, 2008b)."[38] "[T]he current state-of-the-art in promoter prediction is biased toward housekeeping genes that contain CpG islands."[38]
Each of the currently described promoter elements is tested for possible occurrences between ZSCAN22 and A1BG on both the negative and positive strands, and between ZNF497 and A1BG on both strands, going from the neighboring gene toward A1BG.
E boxes [edit]
A1BG has an E-box: 3'-CACTTG-5' ending at -449 nt (G) in the distal promoter region.
MREs [edit]
On the negative strand going from ZSCAN22 to A1BG, there are no MREs.
eIF4Es [edit]
A1BG does not have an eIF4E basal element (4EBE) on the negative strand going from ZSCAN22 to A1BG.
HY boxes [edit]
A1BG has an HY box but it ends at -440 nt in the distal promoter.
CAAT boxes [edit]
A1BG does not have a CAAT box in the transcription direction along the negative strand from ZSCAN22 to A1BG.
GC boxes [edit]
A1BG does not have a GC box in the transcription direction on either the positive or negative strand (ZSCAN22 to A1BG).
BREs [edit]
There are three B recognition elements (BREs) going along the negative strand from ZSCAN22 to A1BG: 3'-CCACGCC-5' out 380 nts from the last nt of the ending untranslated region for ZSCAN22, 3'-CCGCGCC-5' out 1762, and 3'-CCACGCC-5' out 2197 nts.
"The position in nucleotides (nts) relative to the transcription start site (TSS, +1)" is -35 for the BRE."[25] None of the three BREs located are anywhere near the TSS at some 4600 nts out from ZSCAN22.
TATA boxes [edit]
On the positive strand, in the nucleotide region between gene ZSCAN22 (NCBI GeneID: 342945) and A1BG (NCBI GeneID: 1) are 211 TATA box-like 8 nt long sequences. Of these,
- TATAAAAG occurs at 58853713 + 183 nts and
- TATAAAAG at 58853713 + 222. This is a TATA box found with some genes.[39] But, the optimal TBP recognition sequence 3'-TATATAAG-5',[40] does not occur.
- TATATAAA occurs only once at 2874 nts from the end of ZSCAN22. TBP is bound to this sequence and TATAAAAG above.[41][42]
- TATAAA occurs seven times, with the closest one at 2874 nts from the end of ZSCAN22. "In virtually every RNA polymerase II-transcribed gene examined, the sequence TATAAA was present 25 to 30 nts upstream of the transcription start site."[3]
A1BG does not have a TATA box in the core promoter region. There is the sequence 3'-TGCTATATAGATGGCAACTAAGCACTTGGGGAAAAAA-5' for which the first nt (T) is number 58856598 or 1574 nt upstream from the beginning of the 3'-UTR at 58858172. Unless another variant exists, -1574 nt from the beginning of the 3'-UTR is a large number of nts away from the TSS.
The closest TATA box-like sequence is 3'-CTCTTAAG-5' on the template strand at 4408 nts from the end of ZSCAN22, which is upstream from the core promoter.
The extra TATA boxes between ZSCAN22 and A1BG strongly suggest that there is at least one gene (or pseudogene) between ZSCAN22 and A1BG not currently in the NCBI database.
On the negative strand between ZNF497 and A1BG, there are no TATA boxes of the form 3’-TATA-A/T-A-A/T-A/G-5’.
For the negative strand going from ZSCAN22 to A1BG there are two TATA boxes: 3'-TATATATA-5' at 1600 nts and 3'-TATATAAA-5' at 1602 nts. These are way too far from the possible TSS in this direction.
dBREs [edit]
A1BG does not have a TATA box. The closest 7 nucleotide dBRE is at -450 nts which is outside the core promoter in the distal promoter. The closest 6 nt dBRE of consensus sequence 3'-A/G-T-A/G/T-G/T-G/T-G/T-5' is also at -451 nts.
Consensus sequence 3'-T-A/G/T-G/T-G/T-G/T-G/T-5' has an expression at -108 nts with 3'-TGGGTG-5' in the proximal promoter.
Consensus sequence 3'-A/G-T-A/G/T-G/T-G/T-5' has one dBRE at -99 nts with 3'-GTGTG-5' in the proximal promoter.
3'-T-A/G/T-G/T-G/T-G/T-5' is another 5 nts consensus sequence that has a dBRE at -109 nts with 3'-TGGGT-5'.
Another 5 nts consensus sequence that has the same dBRE at -99 nts is 3'-GTGTG-5' in the proximal promoter.
A 4 nts consensus sequence has a dBRE at -100 nts is 3'-GTGT-5' also in the proximal promoter.
A second set of 4 nts consensus sequence dBREs are at -59 nts and +2 nts. The dBRE has not been reported to include the TSS.
A third 4 nts consensus sequence dBRE occurs at -43 nts, roughly just outside the core promoter, with another including the TSS and none in between.
XCPE 1s [edit]
A1BG does not have an X core promoter element 1 (XCPE1).
MTEs [edit]
A1BG does not have a motif ten element (MTE).
GAACs [edit]
A1BG does not have a GAAC element within 2-7 nucleotides of the TSS. The closest GAAC element, 3'-GAACT-5', is -999 nts from the TSS.
Inrs [edit]
Along the negative strand from ZSCAN22 to A1BG there are at least 43 initiator elements, with the closest one 3'-TCACACT-5' ending at 4361 nts rather than including the TSS of A+1 at 4460 nts.
In the sequence along the positive strand of nucleotides from genes ZSCAN22 and A1BG, the sequence 3'-CCATCCACT-5' occurs only once, just before the transcription start site (TSS) of the A1BG gene. The DCE 3'-CTT-5' contains the TSS at its 5' end.
The TSS for A1BG has the following nts around it: 3'-CCATCCACTT+1TGAGGACAC-5'. Most genes studied early on contained an adenosine (A+1) at the TSS, a cytosine (C-1), and a few pyrimidines (Pys) surrounding these nts.[43]
Usually the Inr contains the TSS. The sequence 3'-CCACTT+1T-5' does contain the TSS but not at A+1. The nearest other Inr ends -24 nt upstream from the TSS.
There are at least 15 Inrs between ZSCAN22 and A1BG.
The sequence 3'-CCACTT+1T-5' is also an Inr, where the TSS is indicated. But, the only DPE nearby 3'-GGACA-5' begins on the fourth nt (+5) after the TSS (+1), not precisely +28 to +32 relative to the TSS nucleotide. No other DPE is even close to this +28 to +32 window.
AGCE1s [edit]
A1BG contains 3'-CTT+1-5'. This is an angiotensinogen core promoter element 1 (AGCE1).
The AGCE1 occurs at 3'-CTT+1-5' and 3'-ATC-5' which ends 5 nts upstream from the first and is the only AGCE1 within -25 and -1 nts of the TSS.
DCEs [edit]
The downstream core element (DCE) SI 3'-CTT+1-5' contains the TSS but is not downstream of the TSS. Of the DCE SI elements, the closest is some 60 nts downstream from the TSS (3'-CTTC-5' ending at +69).
Of the DCE SII elements such as 3'-CTGT-5', there are none within +1 to +100 nts downstream. Element 3'-CTG-5' occurs starting at +32 nts, which is some +11 nts further downstream than expected and falls within the range for SIII. The element 3’-TGT-5’ has no occurrence within the TSS and +100 nts downstream.
DCE SIII elements (3’-AGC-5’) occur at +19 and +28 nts. The second DCE SIII is close but overlaps any likely nts for DCE SII and is supposed to be after any DCE SII. The DCE SII is unlikely to be used but the second DCE SIII may be close enough to act alone.
Along the negative strand from ZSCAN22 to A1BG and past the TSS, there are no DCE SIs of the type 3'-CTTC-5' past the TSS. Of the type 3'-CTT-5', only one occurs at 4552 nts or 92 nts past the TSS. For type 3'-TTC-5' of DCE SI the closest past is 3'-TTC-5' ending at 4504, or 44 nts past the TSS.
Type SII 3'-CTGT-5' has the closest one ending at 4468 nts and the next ending at 4507 nts.
DPEs [edit]
Within the nucleotides of the negative strand going from gene ZSCAN22 to A1BG are at least 163 downstream promoter elements (DPEs), when using the minimal five-nucleotide consensus sequence. There are three DPEs near the required +28 (4487) to +32 (4491) nts from the TSS at 4460 nts from the end of ZSCAN22: 3'-GGTCG-5' at 4480, 3'-AGTCG-5' at 4489, and 3'-GGACC-5' at 4494 nts.
TAFs [edit]
Each of the foregoing core promoter elements does not appear to be involved in the transcription of A1BG. The Inr does not contain the known TSS. The DCE is not supposed to contain the TSS, nor is AGCE1 although it is one nt off by containing it. Currently, the only way to default transcribe A1BG is by directing the transcription program directly to the known TSS.
When there is no TATA box in the promoter, a TAF binds sequence specifically, and forces the TBP to bind non-sequence specifically.
5'-untranslated region [edit]
The 5' UTR for A1BG contains some 216 nts, depending upon the location of the TSS.
3’-T+1TGAGGACACGAGATCCCAGCCCACTCAGCCCTGGGAGTCCAAAGACATTTTAAACAGAGCCTCTCTTCACATTTA TTAATTCCTGGGAGGAATGAGGGAGGCTTCTCCAGCCCCCCAGAGACCCCGGCCTTGTGCTGCAACAGGAGGGGA GGGAGCCAGTCCAGAATCCCCGGCACTTCTGAGGACACCAACAGCACCCTGGGCCCGCGGCTGCA-5’
From the Wikipedia article on the five prime untranslated region, “The five prime untranslated region (5' UTR), can contain elements for controlling gene expression by way of regulatory elements. It begins at the transcription start site and ends one nucleotide (nt) before the start codon (usually AUG) of the coding region. ... The 5' UTR has a median length of ~150 nt in eukaryotes, but can be as long as several thousand bases. ... Several regulatory sequences may be found in the 5' UTR:
- Binding sites for proteins, that may affect the mRNA's stability or translation, for example iron responsive elements, that regulate gene expression in response to iron.
- Riboswitches.
- Sequences that promote or inhibit translation initiation.
- Introns within 5' UTRs have been linked to regulation of gene expression and mRNA export[44].”
TBP binding [edit]
If TBP can bind to any variety of seven A/Ts before the TSS, then the sequence 3'-AAAAAATAATAATTA-5' is likely to be the 3'-"xod-ATAT"-5', rather than the traditional 3'-"TATA-box"-5'. The first (T)-5' is at 58858405, only 233 nts from TSS, but way outside the core promoter.
RNA polymerase II holoenzyme [edit]
From the Wikipedia article on RNA polymerase II holoenzyme, "RNA polymerase II ... is recruited to the promoters of protein-coding genes in living cells.[45]" Or, transcription factories are present and the euchromatin is brought within the nearest transcription factory and A1BG messenger RNA (mRNA) is transcribed.
For those circumstances in which the holoenzyme is built onto the euchromatin, it is necessary to consider the holoenzyme components and the likely sequence of binding, RNA polymerase II entrance upon the scene and subsequent action.
"RNA polymerase II (also called RNAP II and Pol II) ... catalyzes the transcription of DNA to synthesize precursors of mRNA and most snRNA and microRNA.[46] ... In humans RNAP II consists of seventeen protein molecules (gene products encoded by POLR2A-L, where the proteins synthesized from 2C-, E-, and F-form homodimers).", per RNA polymerase II holoenzyme.
See also [edit]
References [edit]
- ↑ 1.0 1.1 Script error
- ↑ Ginger Lehrman and Ian B Hogue, Sarah Palmer, Cheryl Jennings, Celsa A Spina, Ann Wiegand, Alan L Landay, Robert W Coombs, Douglas D Richman, John W Mellors, John M Coffin, Ronald J Bosch, David M Margolis (August 13, 2005). "Depletion of latent HIV-1 infection in vivo: a proof-of-concept study". Lancet 366 (9485): 549-55. doi:10.1016/S0140-6736(05)67098-5. Retrieved on 2012-05-09.
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 3.6 Stephen T. Smale and James T. Kadonaga (July 2003). "The RNA Polymerase II Core Promoter". Annual Review of Biochemistry 72 (1): 449-79. doi:10.1146/annurev.biochem.72.121801.161520. PMID 12651739. Retrieved on 2012-05-07.
- ↑ Bork P, Holm L, Sander C (September 1994). "The immunoglobulin fold. Structural classification, sequence patterns and common core". Journal of Molecular Biology 242 (4): 309–20. doi:10.1006/jmbi.1994.1582. PMID 7932691.
- ↑ Brümmendorf T, Rathjen FG (1995). "Cell adhesion molecules 1: immunoglobulin superfamily". Protein Profile 2 (9): 963–1108. PMID 8574878.
- ↑ (June 29, 2012) "Immunoglobulin domain". Wikipedia. San Francisco, California: Wikimedia Foundation, Inc. Retrieved on 2012-07-15.
- ↑ 7.0 7.1 Script error
- ↑ 8.0 8.1 Edda Topfer-Petersen, Mahnaz Ekhlasi-Hundrieser, Christiane Kirchhoff, Tosso Leeb, Harald Sieme (October 2005). "The role of stallion seminal proteins in fertilisation". Animal Reproduction Science 89 (1-4): 159-70. doi:10.1016/j.anireprosci.2005.06.018. Retrieved on 2012-02-26.
- ↑ Lucy J. Schmidt, Kevin M. Regan, S. Keith Anderson, Zhifu Sun, Karla V. Ballman, Donald J. Tindall (December 2009). "Effects of the 5 alpha‐reductase inhibitor dutasteride on gene expression in prostate cancer xenografts". The Prostate 69 (16): 1730-43. doi:10.1002/pros.21022. PMID 19676081. Retrieved on 2012-02-26.
- ↑ 10.0 10.1 10.2 10.3 Udby L, Sørensen OE, Pass J, Johnsen AH, Behrendt N, Borregaard N, Kjeldsen L. (October 2004). "Cysteine-rich secretory protein 3 is a ligand of alpha1B-glycoprotein in human plasma". Biochemistry 43 (40): 12877-86. doi:10.1021/bi048823e. PMID 15461460. Retrieved on 2011-11-28.
- ↑ Script error
- ↑ Journal Of Venomous Animals And Toxins – Anti-Lethal Factor From Opossum Serum Is A Potent Antidote For Animal, Plant And Bacterial Toxins. Retrieved 2009-12-29.
- ↑ (February 3, 2013) "Opossum". Wikipedia. San Francisco, California: Wikimedia Foundation, Inc. Retrieved on 2013-02-06.
- ↑ 14.0 14.1 B Haendler, J Krätzschmar, F Theuring and W D Schleuning (July 1993). "Transcripts for cysteine-rich secretory protein-1 (CRISP-1; DE/AEG) and the novel related CRISP-3 are expressed under androgen control in the mouse salivary gland.". Endocrinology 133 (1): 192-8. doi:10.1210/en.133.1.192. PMID 8319566. Retrieved on 2012-02-20.
- ↑ 15.0 15.1 15.2 Mei Tian, Ya-Zhou Cui, Guan-Hua Song, Mei-Juan Zong, Xiao-Yan Zhou, Yu Chen and Jin-Xiang Han (August 2008). "Proteomic analysis identifies MMP-9, DJ-1 and A1BG as overexpressed proteins in pancreatic juice from pancreatic ductal adenocarcinoma patients". BMC Cancer 16 (8): 241. PMID 18706098. Retrieved on 2011-11-28.
- ↑ 16.0 16.1 16.2 (February 12, 2013) "Sense (molecular biology)". Wikipedia. San Francisco, California: Wikimedia Foundation, Inc. Retrieved on 2013-02-14.
- ↑ 17.0 17.1 Thomas Abeel, Yvan Saeys, Eric Bonnet, Pierre Rouzé, and Yves Van de Peer (February 2008). "Generic eukaryotic core promoter prediction using structural features of DNA". Genome Research 18 (2): 310-23. doi:10.1101/gr.6991408. Retrieved on 2012-04-04.
- ↑ Jaideep Chaudhary, Michael K. Skinner. "Basic Helix-Loop-Helix Proteins Can Act at the E-Box within the Serum Response Element of the c-fos Promoter to Influence Hormone-Induced Promoter Activation in Sertoli Cells". Molecular Endocrinology 12 (5): 774–786.
- ↑ (April 13, 2013) "E-box". Wikipedia. San Francisco, California: Wikimedia Foundation, Inc. Retrieved on 2013-04-17.
- ↑ Barbara Levinson, Rebecca Conant, Rhonda Schnur, Soma Das, Seymour Packman and Jane Gitschier (1996). "A Repeated Element in the Regulatory Region of the MNK Gene and Its Deletion in A Patient With Occipital Horn Syndrome". Human Molecular Genetics 5 (11): 1737-42. doi:10.1093/hmg/5.11.1737. Retrieved on 2013-04-15.
- ↑ 21.0 21.1 Jennifer E.F. Butler, James T. Kadonaga (October 15, 2002). "The RNA polymerase II core promoter: a key component in the regulation of gene expression". Genes & Development 16 (20): 2583–2592. doi:10.1101/gad.1026202. PMID 12381658.
- ↑ (January 29, 2013) "Promoter (genetics)". Wikipedia. San Francisco, California: Wikimedia Foundation, Inc. Retrieved on 2013-02-12.
- ↑ 23.0 23.1 Gillian E. Chalkley and C. Peter Verrijzer (September 1, 1999). "DNA binding site selection by RNA polymerase II TAFs: a TAFII250-TAFII150 complex recognizes the Initiator". The EMBO Journal 18 (17): 4835-45. PMID 10469661. Retrieved on 2012-04-26.
- ↑ S. T. Smale (1997). "Transcription initiation from TATA-less promoters within eukaryotic protein-coding genes". Biochim. Biophys. Acta. 1351: 73-88. Retrieved on 2012-04-26.
- ↑ 25.0 25.1 25.2 25.3 25.4 Chuhu Yang, Eugene Bolotin, Tao Jiang, Frances M. Sladek, Ernest Martinez. (March 7, 2007). "Prevalence of the initiator over the TATA box in human and yeast genes and identification of DNA motifs enriched in human TATA-less core promoters". Gene 389 (1): 52-65. doi:10.1016/j.gene.2006.09.029. PMID 17123746.
- ↑ Saxonov S, Berg P, Brutlag DL (2006). "A genome-wide analysis of CpG dinucleotides in the human genome distinguishes two distinct classes of promoters". Proc Natl Acad Sci USA 103 (5): 1412–1417. doi:10.1073/pnas.0510310103. PMID 16432200.
- ↑ H Imataka, K Sogawa, KI Yasumoto, Y Kikuchi, K Sasano, A Kobayashi, M Hayami, and Y Fujii-Kuriyama (October 1992). "Two regulatory proteins that bind to the basic transcription element (BTE), a GC box sequence in the promoter region of the rat P-4501A1 gene". The EMBO Journal 11 (10): 3663-71. PMID 1356762. Retrieved on 2013-01-27.
- ↑ Alan K. Kutach, James T. Kadonaga (July 2000). "The Downstream Promoter Element DPE Appears To Be as Widely Used as the TATA Box in Drosophila Core Promoters". Molecular and Cellular Biology 20 (13): 4754-64. PMID 10848601. Retrieved on 2012-07-15.
- ↑ 29.0 29.1 Wensheng Deng, Stefan G.E. Roberts (October 15, 2005). "A core promoter element downstream of the TATA box that is recognized by TFIIB". Genes & Development 19 (20): 2418–23. doi:10.1101/gad.342405. PMID 16230532.
- ↑ J. Carcamo, L. Buckbinder and D. Reinberg (1991). "The initiator directs the assembly of a transcription factor IID-dependent transcription complex". Proceedings of the National Academy of Sciences USA 88: 8052-6. Retrieved on 2012-04-26.
- ↑ L. Weis and D. Reinberg (1997). "Accurate positioning of RNA polymerase II on a natural TATA-less promoter is independent of TATA-binding protein associated factors and initiator-binding proteins". Mol. Cell. Biol. 17: 2973-84. Retrieved on 2012-04-26.
- ↑ 32.0 32.1 Tamar Juven-Gershon, Jer-Yuan Hsu, Joshua W. M. Theisen, and James T. Kadonaga (June 2008). "The RNA Polymerase II Core Promoter – the Gateway to Transcription". Current Opinion in Cell Biology 20 (3): 253-9. doi:10.1016/j.ceb.2008.03.003. Retrieved on 2013-02-13.
- ↑ Noriyuki Sato; Tomohiro Katsuya; Hiromi Rakugi; Seiju Takami; Yukiko Nakata; Tetsuro Miki; Jitsuo Higaki; Toshio Ogihara (September 1997). "Association of Variants in Critical Core Promoter Element of Angiotensinogen Gene With Increased Risk of Essential Hypertension in Japanese". Hypertension 30 (3 Pt 1): 321-5. doi:10.1161/01.HYP.30.3.321. PMID 9314411. Retrieved on 2012-02-20.
- ↑ 34.0 34.1 34.2 34.3 34.4 Dong-Hoon Lee, Naum Gershenzon, Malavika Gupta, Ilya P. Ioshikhes, Danny Reinberg and Brian A. Lewis (November 2005). "Functional Characterization of Core Promoter Elements: the Downstream Core Element Is Recognized by TAF1". Molecular and Cellular Biology 25 (21): 9674-86. doi:10.1128/MCB.25.21.9674-9686.2005. PMID 16227614. Retrieved on 2010-10-23.
- ↑ Tamar Juven-Gershon, James T. Kadonaga (March 15, 2010). "Regulation of Gene Expression via the Core Promoter and the Basal Transcriptional Machinery". Developmental Biology 339 (2): 225–9. doi:10.1016/j.ydbio.2009.08.009. PMID 19682982.
- ↑ Script error
- ↑ Script error
- ↑ 38.0 38.1 38.2 38.3 Thomas Abeel, Yves Van de Peer and Yvan Saeys (September 2009). "Toward a gold standard for promoter prediction evaluation". Bioinformatics 25 (12): i313-20. doi:10.1093/bioinformatics/btp191. Retrieved on 2012-04-04.
- ↑ GA Patikoglou, JL Kim, L Sun, SH Yang, T Kodadek, SK Burley (1999). "". Genes Development 13: 3217-30. Retrieved on 2012-06-12.
- ↑ J. Wong, E. Bateman (1994). "". Nucleic Acids Research 22: 1890-96. Retrieved on 2012-06-12.
- ↑ JL Kim, DB Nikolov, SK Burley (1993). "". Nature 365: 520-7. Retrieved on 2012-06-12.
- ↑ YC Kim, JH Geiger, S Hahn, PB Sigler (1993). "". Nature 365: 512-20. Retrieved on 2012-06-12.
- ↑ J Corden, B Wasylyk, A Buchwalder, P Sassone-Corsi, C. Kedinger, P. Chambon (1980). "". Science 209: 1405-14. Retrieved on 2012-06-12.
- ↑ Cenik, C, et al. (2011). "Genome analysis reveals interplay between 5' UTR introns and nuclear mRNA export for secretory and mitochondrial genes". PLoS Genetics 7 (4). doi:10.1371/journal.pgen.1001366.
- ↑ Myer VE, Young RA (October 1998). "RNA polymerase II holoenzymes and subcomplexes". J. Biol. Chem. 273 (43): 27757–60. doi:10.1074/jbc.273.43.27757. PMID 9774381.
- ↑ Kornberg R (1999). "Eukaryotic transcriptional control". Trends in Cell Biology 9 (12): M46. doi:10.1016/S0962-8924(99)01679-7. PMID 10611681.
Further reading [edit]
- Javahery R, Khachi A, Lo K, Zenzie-Gregory B, Smale ST (Jan 1994). "DNA Sequence Requirements for Transcriptional Initiator Activity in Mammalian Cells". Mol Cell Biol. 14 (1): 116-27. PMID 8264580.
- Liston DR, Johnson PJ (Mar 1999). "Analysis of a Ubiquitous Promoter Element in a Primitive Eukaryote: Early Evolution of the Initiator Element". Mol Cell Biol. 19 (3): 2380-8.
- Myer VE, Young RA (October 1998). "RNA polymerase II holoenzymes and subcomplexes". J. Biol. Chem. 273 (43): 27757–60. doi:10.1074/jbc.273.43.27757. PMID 9774381.
External links [edit]
- African Journals Online
- Bing Advanced search
- GenomeNet KEGG database
- Google Books
- Google scholar Advanced Scholar Search
- Home - Gene - NCBI
- JSTOR
- Lycos search
- NCBI All Databases Search
- NCBI Site Search
- PubChem Public Chemical Database
- Questia - The Online Library of Books and Journals
- SAGE journals online
- Scirus for scientific information only advanced search
- SpringerLink
- Taylor & Francis Online
- Virtual Cell Animation Collection, Introducing Transcription
- WikiDoc The Living Textbook of Medicine
- Wiley Online Library Advanced Search
- Yahoo Advanced Web Search
|
||||||||||||||||||||||||||||||||||||||||||||
|
||||||||||||||||||||||||||||||||
This is a research project at http://en.wikiversity.org
|
Learn more about A1BG
|
|
Learn more about Transcription
|


